ID: 906940548

View in Genome Browser
Species Human (GRCh38)
Location 1:50251748-50251770
Sequence GAAGCAGAAGTGGGGAAGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906940548_906940561 14 Left 906940548 1:50251748-50251770 CCGTACTTCCCCACTTCTGCTTC No data
Right 906940561 1:50251785-50251807 CTGTAAATACAGTGGGAACCTGG No data
906940548_906940556 6 Left 906940548 1:50251748-50251770 CCGTACTTCCCCACTTCTGCTTC No data
Right 906940556 1:50251777-50251799 CCAGACCCCTGTAAATACAGTGG No data
906940548_906940557 7 Left 906940548 1:50251748-50251770 CCGTACTTCCCCACTTCTGCTTC No data
Right 906940557 1:50251778-50251800 CAGACCCCTGTAAATACAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906940548 Original CRISPR GAAGCAGAAGTGGGGAAGTA CGG (reversed) Intergenic
No off target data available for this crispr