ID: 906940551

View in Genome Browser
Species Human (GRCh38)
Location 1:50251758-50251780
Sequence CTGGGGAAAGGAAGCAGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906940551_906940565 25 Left 906940551 1:50251758-50251780 CCACTTCTGCTTCCTTTCCCCAG No data
Right 906940565 1:50251806-50251828 GGCTTTCTGAATGAGATGGGAGG No data
906940551_906940564 22 Left 906940551 1:50251758-50251780 CCACTTCTGCTTCCTTTCCCCAG No data
Right 906940564 1:50251803-50251825 CCTGGCTTTCTGAATGAGATGGG No data
906940551_906940561 4 Left 906940551 1:50251758-50251780 CCACTTCTGCTTCCTTTCCCCAG No data
Right 906940561 1:50251785-50251807 CTGTAAATACAGTGGGAACCTGG No data
906940551_906940557 -3 Left 906940551 1:50251758-50251780 CCACTTCTGCTTCCTTTCCCCAG No data
Right 906940557 1:50251778-50251800 CAGACCCCTGTAAATACAGTGGG No data
906940551_906940556 -4 Left 906940551 1:50251758-50251780 CCACTTCTGCTTCCTTTCCCCAG No data
Right 906940556 1:50251777-50251799 CCAGACCCCTGTAAATACAGTGG No data
906940551_906940562 21 Left 906940551 1:50251758-50251780 CCACTTCTGCTTCCTTTCCCCAG No data
Right 906940562 1:50251802-50251824 ACCTGGCTTTCTGAATGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906940551 Original CRISPR CTGGGGAAAGGAAGCAGAAG TGG (reversed) Intergenic
No off target data available for this crispr