ID: 906940552

View in Genome Browser
Species Human (GRCh38)
Location 1:50251770-50251792
Sequence ATTTACAGGGGTCTGGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906940552_906940564 10 Left 906940552 1:50251770-50251792 CCTTTCCCCAGACCCCTGTAAAT No data
Right 906940564 1:50251803-50251825 CCTGGCTTTCTGAATGAGATGGG No data
906940552_906940562 9 Left 906940552 1:50251770-50251792 CCTTTCCCCAGACCCCTGTAAAT No data
Right 906940562 1:50251802-50251824 ACCTGGCTTTCTGAATGAGATGG No data
906940552_906940565 13 Left 906940552 1:50251770-50251792 CCTTTCCCCAGACCCCTGTAAAT No data
Right 906940565 1:50251806-50251828 GGCTTTCTGAATGAGATGGGAGG No data
906940552_906940561 -8 Left 906940552 1:50251770-50251792 CCTTTCCCCAGACCCCTGTAAAT No data
Right 906940561 1:50251785-50251807 CTGTAAATACAGTGGGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906940552 Original CRISPR ATTTACAGGGGTCTGGGGAA AGG (reversed) Intergenic
No off target data available for this crispr