ID: 906940553

View in Genome Browser
Species Human (GRCh38)
Location 1:50251775-50251797
Sequence ACTGTATTTACAGGGGTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906940553_906940565 8 Left 906940553 1:50251775-50251797 CCCCAGACCCCTGTAAATACAGT No data
Right 906940565 1:50251806-50251828 GGCTTTCTGAATGAGATGGGAGG No data
906940553_906940562 4 Left 906940553 1:50251775-50251797 CCCCAGACCCCTGTAAATACAGT No data
Right 906940562 1:50251802-50251824 ACCTGGCTTTCTGAATGAGATGG No data
906940553_906940564 5 Left 906940553 1:50251775-50251797 CCCCAGACCCCTGTAAATACAGT No data
Right 906940564 1:50251803-50251825 CCTGGCTTTCTGAATGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906940553 Original CRISPR ACTGTATTTACAGGGGTCTG GGG (reversed) Intergenic
No off target data available for this crispr