ID: 906940556

View in Genome Browser
Species Human (GRCh38)
Location 1:50251777-50251799
Sequence CCAGACCCCTGTAAATACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906940548_906940556 6 Left 906940548 1:50251748-50251770 CCGTACTTCCCCACTTCTGCTTC No data
Right 906940556 1:50251777-50251799 CCAGACCCCTGTAAATACAGTGG No data
906940549_906940556 -2 Left 906940549 1:50251756-50251778 CCCCACTTCTGCTTCCTTTCCCC No data
Right 906940556 1:50251777-50251799 CCAGACCCCTGTAAATACAGTGG No data
906940551_906940556 -4 Left 906940551 1:50251758-50251780 CCACTTCTGCTTCCTTTCCCCAG No data
Right 906940556 1:50251777-50251799 CCAGACCCCTGTAAATACAGTGG No data
906940550_906940556 -3 Left 906940550 1:50251757-50251779 CCCACTTCTGCTTCCTTTCCCCA No data
Right 906940556 1:50251777-50251799 CCAGACCCCTGTAAATACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906940556 Original CRISPR CCAGACCCCTGTAAATACAG TGG Intergenic
No off target data available for this crispr