ID: 906940560

View in Genome Browser
Species Human (GRCh38)
Location 1:50251784-50251806
Sequence CAGGTTCCCACTGTATTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906940560_906940564 -4 Left 906940560 1:50251784-50251806 CCTGTAAATACAGTGGGAACCTG No data
Right 906940564 1:50251803-50251825 CCTGGCTTTCTGAATGAGATGGG No data
906940560_906940562 -5 Left 906940560 1:50251784-50251806 CCTGTAAATACAGTGGGAACCTG No data
Right 906940562 1:50251802-50251824 ACCTGGCTTTCTGAATGAGATGG No data
906940560_906940565 -1 Left 906940560 1:50251784-50251806 CCTGTAAATACAGTGGGAACCTG No data
Right 906940565 1:50251806-50251828 GGCTTTCTGAATGAGATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906940560 Original CRISPR CAGGTTCCCACTGTATTTAC AGG (reversed) Intergenic
No off target data available for this crispr