ID: 906940561

View in Genome Browser
Species Human (GRCh38)
Location 1:50251785-50251807
Sequence CTGTAAATACAGTGGGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906940551_906940561 4 Left 906940551 1:50251758-50251780 CCACTTCTGCTTCCTTTCCCCAG No data
Right 906940561 1:50251785-50251807 CTGTAAATACAGTGGGAACCTGG No data
906940550_906940561 5 Left 906940550 1:50251757-50251779 CCCACTTCTGCTTCCTTTCCCCA No data
Right 906940561 1:50251785-50251807 CTGTAAATACAGTGGGAACCTGG No data
906940548_906940561 14 Left 906940548 1:50251748-50251770 CCGTACTTCCCCACTTCTGCTTC No data
Right 906940561 1:50251785-50251807 CTGTAAATACAGTGGGAACCTGG No data
906940549_906940561 6 Left 906940549 1:50251756-50251778 CCCCACTTCTGCTTCCTTTCCCC No data
Right 906940561 1:50251785-50251807 CTGTAAATACAGTGGGAACCTGG No data
906940552_906940561 -8 Left 906940552 1:50251770-50251792 CCTTTCCCCAGACCCCTGTAAAT No data
Right 906940561 1:50251785-50251807 CTGTAAATACAGTGGGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906940561 Original CRISPR CTGTAAATACAGTGGGAACC TGG Intergenic
No off target data available for this crispr