ID: 906940562

View in Genome Browser
Species Human (GRCh38)
Location 1:50251802-50251824
Sequence ACCTGGCTTTCTGAATGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906940551_906940562 21 Left 906940551 1:50251758-50251780 CCACTTCTGCTTCCTTTCCCCAG No data
Right 906940562 1:50251802-50251824 ACCTGGCTTTCTGAATGAGATGG No data
906940555_906940562 2 Left 906940555 1:50251777-50251799 CCAGACCCCTGTAAATACAGTGG No data
Right 906940562 1:50251802-50251824 ACCTGGCTTTCTGAATGAGATGG No data
906940553_906940562 4 Left 906940553 1:50251775-50251797 CCCCAGACCCCTGTAAATACAGT No data
Right 906940562 1:50251802-50251824 ACCTGGCTTTCTGAATGAGATGG No data
906940554_906940562 3 Left 906940554 1:50251776-50251798 CCCAGACCCCTGTAAATACAGTG No data
Right 906940562 1:50251802-50251824 ACCTGGCTTTCTGAATGAGATGG No data
906940552_906940562 9 Left 906940552 1:50251770-50251792 CCTTTCCCCAGACCCCTGTAAAT No data
Right 906940562 1:50251802-50251824 ACCTGGCTTTCTGAATGAGATGG No data
906940549_906940562 23 Left 906940549 1:50251756-50251778 CCCCACTTCTGCTTCCTTTCCCC No data
Right 906940562 1:50251802-50251824 ACCTGGCTTTCTGAATGAGATGG No data
906940558_906940562 -3 Left 906940558 1:50251782-50251804 CCCCTGTAAATACAGTGGGAACC No data
Right 906940562 1:50251802-50251824 ACCTGGCTTTCTGAATGAGATGG No data
906940550_906940562 22 Left 906940550 1:50251757-50251779 CCCACTTCTGCTTCCTTTCCCCA No data
Right 906940562 1:50251802-50251824 ACCTGGCTTTCTGAATGAGATGG No data
906940560_906940562 -5 Left 906940560 1:50251784-50251806 CCTGTAAATACAGTGGGAACCTG No data
Right 906940562 1:50251802-50251824 ACCTGGCTTTCTGAATGAGATGG No data
906940559_906940562 -4 Left 906940559 1:50251783-50251805 CCCTGTAAATACAGTGGGAACCT No data
Right 906940562 1:50251802-50251824 ACCTGGCTTTCTGAATGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906940562 Original CRISPR ACCTGGCTTTCTGAATGAGA TGG Intergenic
No off target data available for this crispr