ID: 906940565

View in Genome Browser
Species Human (GRCh38)
Location 1:50251806-50251828
Sequence GGCTTTCTGAATGAGATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906940558_906940565 1 Left 906940558 1:50251782-50251804 CCCCTGTAAATACAGTGGGAACC No data
Right 906940565 1:50251806-50251828 GGCTTTCTGAATGAGATGGGAGG No data
906940555_906940565 6 Left 906940555 1:50251777-50251799 CCAGACCCCTGTAAATACAGTGG No data
Right 906940565 1:50251806-50251828 GGCTTTCTGAATGAGATGGGAGG No data
906940559_906940565 0 Left 906940559 1:50251783-50251805 CCCTGTAAATACAGTGGGAACCT No data
Right 906940565 1:50251806-50251828 GGCTTTCTGAATGAGATGGGAGG No data
906940554_906940565 7 Left 906940554 1:50251776-50251798 CCCAGACCCCTGTAAATACAGTG No data
Right 906940565 1:50251806-50251828 GGCTTTCTGAATGAGATGGGAGG No data
906940549_906940565 27 Left 906940549 1:50251756-50251778 CCCCACTTCTGCTTCCTTTCCCC No data
Right 906940565 1:50251806-50251828 GGCTTTCTGAATGAGATGGGAGG No data
906940560_906940565 -1 Left 906940560 1:50251784-50251806 CCTGTAAATACAGTGGGAACCTG No data
Right 906940565 1:50251806-50251828 GGCTTTCTGAATGAGATGGGAGG No data
906940550_906940565 26 Left 906940550 1:50251757-50251779 CCCACTTCTGCTTCCTTTCCCCA No data
Right 906940565 1:50251806-50251828 GGCTTTCTGAATGAGATGGGAGG No data
906940552_906940565 13 Left 906940552 1:50251770-50251792 CCTTTCCCCAGACCCCTGTAAAT No data
Right 906940565 1:50251806-50251828 GGCTTTCTGAATGAGATGGGAGG No data
906940551_906940565 25 Left 906940551 1:50251758-50251780 CCACTTCTGCTTCCTTTCCCCAG No data
Right 906940565 1:50251806-50251828 GGCTTTCTGAATGAGATGGGAGG No data
906940553_906940565 8 Left 906940553 1:50251775-50251797 CCCCAGACCCCTGTAAATACAGT No data
Right 906940565 1:50251806-50251828 GGCTTTCTGAATGAGATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906940565 Original CRISPR GGCTTTCTGAATGAGATGGG AGG Intergenic
No off target data available for this crispr