ID: 906941753

View in Genome Browser
Species Human (GRCh38)
Location 1:50261721-50261743
Sequence GAGAGTGTCAGATTAGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906941753_906941757 0 Left 906941753 1:50261721-50261743 CCTTCCCCTAATCTGACACTCTC No data
Right 906941757 1:50261744-50261766 TGCCTTTCCTTCTGCATCTAAGG No data
906941753_906941758 1 Left 906941753 1:50261721-50261743 CCTTCCCCTAATCTGACACTCTC No data
Right 906941758 1:50261745-50261767 GCCTTTCCTTCTGCATCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906941753 Original CRISPR GAGAGTGTCAGATTAGGGGA AGG (reversed) Intergenic
No off target data available for this crispr