ID: 906944811

View in Genome Browser
Species Human (GRCh38)
Location 1:50286619-50286641
Sequence CAAGCTCACCACAACCCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906944811_906944815 -9 Left 906944811 1:50286619-50286641 CCTAAAGGGTTGTGGTGAGCTTG No data
Right 906944815 1:50286633-50286655 GTGAGCTTGTGGGAAGGCCCAGG No data
906944811_906944819 16 Left 906944811 1:50286619-50286641 CCTAAAGGGTTGTGGTGAGCTTG No data
Right 906944819 1:50286658-50286680 TATAGTGAGTGCTCAAGGACAGG No data
906944811_906944818 11 Left 906944811 1:50286619-50286641 CCTAAAGGGTTGTGGTGAGCTTG No data
Right 906944818 1:50286653-50286675 AGGCATATAGTGAGTGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906944811 Original CRISPR CAAGCTCACCACAACCCTTT AGG (reversed) Intergenic
No off target data available for this crispr