ID: 906946307

View in Genome Browser
Species Human (GRCh38)
Location 1:50297292-50297314
Sequence GATATCAGCCTGGCTAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906946298_906946307 28 Left 906946298 1:50297241-50297263 CCCAACACTTTGGGAGGTCGAAG 0: 17
1: 819
2: 18135
3: 171658
4: 302048
Right 906946307 1:50297292-50297314 GATATCAGCCTGGCTAAAACTGG No data
906946299_906946307 27 Left 906946299 1:50297242-50297264 CCAACACTTTGGGAGGTCGAAGC No data
Right 906946307 1:50297292-50297314 GATATCAGCCTGGCTAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906946307 Original CRISPR GATATCAGCCTGGCTAAAAC TGG Intergenic
No off target data available for this crispr