ID: 906946758

View in Genome Browser
Species Human (GRCh38)
Location 1:50301039-50301061
Sequence CACCTATGGCAGAAAGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906946758_906946768 24 Left 906946758 1:50301039-50301061 CCCTGGCCTTTCTGCCATAGGTG No data
Right 906946768 1:50301086-50301108 GGCCCCCTGCATAGAAACAGAGG No data
906946758_906946769 25 Left 906946758 1:50301039-50301061 CCCTGGCCTTTCTGCCATAGGTG No data
Right 906946769 1:50301087-50301109 GCCCCCTGCATAGAAACAGAGGG No data
906946758_906946763 3 Left 906946758 1:50301039-50301061 CCCTGGCCTTTCTGCCATAGGTG No data
Right 906946763 1:50301065-50301087 GAGGCCTCCCCTTCTCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906946758 Original CRISPR CACCTATGGCAGAAAGGCCA GGG (reversed) Intergenic
No off target data available for this crispr