ID: 906946875

View in Genome Browser
Species Human (GRCh38)
Location 1:50301910-50301932
Sequence GGCTCCTGGCCTATCTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906946875_906946886 26 Left 906946875 1:50301910-50301932 CCCTGGCAGATAGGCCAGGAGCC No data
Right 906946886 1:50301959-50301981 ACTTACTGCTCTTGCAAGAAGGG No data
906946875_906946885 25 Left 906946875 1:50301910-50301932 CCCTGGCAGATAGGCCAGGAGCC No data
Right 906946885 1:50301958-50301980 AACTTACTGCTCTTGCAAGAAGG No data
906946875_906946880 -8 Left 906946875 1:50301910-50301932 CCCTGGCAGATAGGCCAGGAGCC No data
Right 906946880 1:50301925-50301947 CAGGAGCCAGGCATGACCCCGGG No data
906946875_906946879 -9 Left 906946875 1:50301910-50301932 CCCTGGCAGATAGGCCAGGAGCC No data
Right 906946879 1:50301924-50301946 CCAGGAGCCAGGCATGACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906946875 Original CRISPR GGCTCCTGGCCTATCTGCCA GGG (reversed) Intergenic
No off target data available for this crispr