ID: 906946880

View in Genome Browser
Species Human (GRCh38)
Location 1:50301925-50301947
Sequence CAGGAGCCAGGCATGACCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906946871_906946880 9 Left 906946871 1:50301893-50301915 CCTCTTAAAGTGAAATTCCCTGG No data
Right 906946880 1:50301925-50301947 CAGGAGCCAGGCATGACCCCGGG No data
906946876_906946880 -9 Left 906946876 1:50301911-50301933 CCTGGCAGATAGGCCAGGAGCCA No data
Right 906946880 1:50301925-50301947 CAGGAGCCAGGCATGACCCCGGG No data
906946875_906946880 -8 Left 906946875 1:50301910-50301932 CCCTGGCAGATAGGCCAGGAGCC No data
Right 906946880 1:50301925-50301947 CAGGAGCCAGGCATGACCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906946880 Original CRISPR CAGGAGCCAGGCATGACCCC GGG Intergenic
No off target data available for this crispr