ID: 906946885

View in Genome Browser
Species Human (GRCh38)
Location 1:50301958-50301980
Sequence AACTTACTGCTCTTGCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906946878_906946885 11 Left 906946878 1:50301924-50301946 CCAGGAGCCAGGCATGACCCCGG No data
Right 906946885 1:50301958-50301980 AACTTACTGCTCTTGCAAGAAGG No data
906946881_906946885 4 Left 906946881 1:50301931-50301953 CCAGGCATGACCCCGGGATACTT No data
Right 906946885 1:50301958-50301980 AACTTACTGCTCTTGCAAGAAGG No data
906946876_906946885 24 Left 906946876 1:50301911-50301933 CCTGGCAGATAGGCCAGGAGCCA No data
Right 906946885 1:50301958-50301980 AACTTACTGCTCTTGCAAGAAGG No data
906946884_906946885 -8 Left 906946884 1:50301943-50301965 CCGGGATACTTTTAGAACTTACT No data
Right 906946885 1:50301958-50301980 AACTTACTGCTCTTGCAAGAAGG No data
906946883_906946885 -7 Left 906946883 1:50301942-50301964 CCCGGGATACTTTTAGAACTTAC No data
Right 906946885 1:50301958-50301980 AACTTACTGCTCTTGCAAGAAGG No data
906946882_906946885 -6 Left 906946882 1:50301941-50301963 CCCCGGGATACTTTTAGAACTTA No data
Right 906946885 1:50301958-50301980 AACTTACTGCTCTTGCAAGAAGG No data
906946875_906946885 25 Left 906946875 1:50301910-50301932 CCCTGGCAGATAGGCCAGGAGCC No data
Right 906946885 1:50301958-50301980 AACTTACTGCTCTTGCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906946885 Original CRISPR AACTTACTGCTCTTGCAAGA AGG Intergenic
No off target data available for this crispr