ID: 906950819

View in Genome Browser
Species Human (GRCh38)
Location 1:50333423-50333445
Sequence CTGCGGTGCTGTGTGACCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906950819_906950822 -10 Left 906950819 1:50333423-50333445 CCCAAGGTCACACAGCACCGCAG No data
Right 906950822 1:50333436-50333458 AGCACCGCAGTGGCACAGCCAGG No data
906950819_906950826 13 Left 906950819 1:50333423-50333445 CCCAAGGTCACACAGCACCGCAG No data
Right 906950826 1:50333459-50333481 ACTGGCACCCACACCTCCCGCGG No data
906950819_906950824 -5 Left 906950819 1:50333423-50333445 CCCAAGGTCACACAGCACCGCAG No data
Right 906950824 1:50333441-50333463 CGCAGTGGCACAGCCAGGACTGG No data
906950819_906950832 26 Left 906950819 1:50333423-50333445 CCCAAGGTCACACAGCACCGCAG No data
Right 906950832 1:50333472-50333494 CCTCCCGCGGAACCTTGCAGGGG No data
906950819_906950829 24 Left 906950819 1:50333423-50333445 CCCAAGGTCACACAGCACCGCAG No data
Right 906950829 1:50333470-50333492 CACCTCCCGCGGAACCTTGCAGG No data
906950819_906950830 25 Left 906950819 1:50333423-50333445 CCCAAGGTCACACAGCACCGCAG No data
Right 906950830 1:50333471-50333493 ACCTCCCGCGGAACCTTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906950819 Original CRISPR CTGCGGTGCTGTGTGACCTT GGG (reversed) Intergenic