ID: 906951753

View in Genome Browser
Species Human (GRCh38)
Location 1:50340708-50340730
Sequence CTGTGATTCTAGAAGAGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906951753_906951756 5 Left 906951753 1:50340708-50340730 CCATCCCTCTTCTAGAATCACAG No data
Right 906951756 1:50340736-50340758 GCCTCTCTCACACTTGTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906951753 Original CRISPR CTGTGATTCTAGAAGAGGGA TGG (reversed) Intergenic
No off target data available for this crispr