ID: 906951756

View in Genome Browser
Species Human (GRCh38)
Location 1:50340736-50340758
Sequence GCCTCTCTCACACTTGTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906951751_906951756 11 Left 906951751 1:50340702-50340724 CCCAGGCCATCCCTCTTCTAGAA No data
Right 906951756 1:50340736-50340758 GCCTCTCTCACACTTGTTGATGG No data
906951754_906951756 1 Left 906951754 1:50340712-50340734 CCCTCTTCTAGAATCACAGACTG No data
Right 906951756 1:50340736-50340758 GCCTCTCTCACACTTGTTGATGG No data
906951750_906951756 16 Left 906951750 1:50340697-50340719 CCTATCCCAGGCCATCCCTCTTC No data
Right 906951756 1:50340736-50340758 GCCTCTCTCACACTTGTTGATGG No data
906951749_906951756 17 Left 906951749 1:50340696-50340718 CCCTATCCCAGGCCATCCCTCTT No data
Right 906951756 1:50340736-50340758 GCCTCTCTCACACTTGTTGATGG No data
906951747_906951756 21 Left 906951747 1:50340692-50340714 CCCACCCTATCCCAGGCCATCCC No data
Right 906951756 1:50340736-50340758 GCCTCTCTCACACTTGTTGATGG No data
906951752_906951756 10 Left 906951752 1:50340703-50340725 CCAGGCCATCCCTCTTCTAGAAT No data
Right 906951756 1:50340736-50340758 GCCTCTCTCACACTTGTTGATGG No data
906951755_906951756 0 Left 906951755 1:50340713-50340735 CCTCTTCTAGAATCACAGACTGA No data
Right 906951756 1:50340736-50340758 GCCTCTCTCACACTTGTTGATGG No data
906951746_906951756 24 Left 906951746 1:50340689-50340711 CCACCCACCCTATCCCAGGCCAT No data
Right 906951756 1:50340736-50340758 GCCTCTCTCACACTTGTTGATGG No data
906951753_906951756 5 Left 906951753 1:50340708-50340730 CCATCCCTCTTCTAGAATCACAG No data
Right 906951756 1:50340736-50340758 GCCTCTCTCACACTTGTTGATGG No data
906951748_906951756 20 Left 906951748 1:50340693-50340715 CCACCCTATCCCAGGCCATCCCT No data
Right 906951756 1:50340736-50340758 GCCTCTCTCACACTTGTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906951756 Original CRISPR GCCTCTCTCACACTTGTTGA TGG Intergenic
No off target data available for this crispr