ID: 906953959

View in Genome Browser
Species Human (GRCh38)
Location 1:50357374-50357396
Sequence GGCGTTGAGCAAGAGCGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906953959_906953965 30 Left 906953959 1:50357374-50357396 CCAGCTCGCTCTTGCTCAACGCC No data
Right 906953965 1:50357427-50357449 CTGATTACTAACAAGATCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906953959 Original CRISPR GGCGTTGAGCAAGAGCGAGC TGG (reversed) Intergenic
No off target data available for this crispr