ID: 906954185

View in Genome Browser
Species Human (GRCh38)
Location 1:50358888-50358910
Sequence GCCCCGTGTGGCTCTCGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906954185_906954202 23 Left 906954185 1:50358888-50358910 CCCACCCGAGAGCCACACGGGGC No data
Right 906954202 1:50358934-50358956 AGGGAGGCAGTGAGTGAGCATGG No data
906954185_906954196 7 Left 906954185 1:50358888-50358910 CCCACCCGAGAGCCACACGGGGC No data
Right 906954196 1:50358918-50358940 CCCCTACCCGCAGCCAAGGGAGG No data
906954185_906954194 4 Left 906954185 1:50358888-50358910 CCCACCCGAGAGCCACACGGGGC No data
Right 906954194 1:50358915-50358937 GAGCCCCTACCCGCAGCCAAGGG No data
906954185_906954193 3 Left 906954185 1:50358888-50358910 CCCACCCGAGAGCCACACGGGGC No data
Right 906954193 1:50358914-50358936 GGAGCCCCTACCCGCAGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906954185 Original CRISPR GCCCCGTGTGGCTCTCGGGT GGG (reversed) Intergenic