ID: 906954186

View in Genome Browser
Species Human (GRCh38)
Location 1:50358889-50358911
Sequence TGCCCCGTGTGGCTCTCGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906954186_906954196 6 Left 906954186 1:50358889-50358911 CCACCCGAGAGCCACACGGGGCA No data
Right 906954196 1:50358918-50358940 CCCCTACCCGCAGCCAAGGGAGG No data
906954186_906954202 22 Left 906954186 1:50358889-50358911 CCACCCGAGAGCCACACGGGGCA No data
Right 906954202 1:50358934-50358956 AGGGAGGCAGTGAGTGAGCATGG No data
906954186_906954193 2 Left 906954186 1:50358889-50358911 CCACCCGAGAGCCACACGGGGCA No data
Right 906954193 1:50358914-50358936 GGAGCCCCTACCCGCAGCCAAGG No data
906954186_906954194 3 Left 906954186 1:50358889-50358911 CCACCCGAGAGCCACACGGGGCA No data
Right 906954194 1:50358915-50358937 GAGCCCCTACCCGCAGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906954186 Original CRISPR TGCCCCGTGTGGCTCTCGGG TGG (reversed) Intergenic