ID: 906954188

View in Genome Browser
Species Human (GRCh38)
Location 1:50358892-50358914
Sequence CCCTGCCCCGTGTGGCTCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906954188_906954194 0 Left 906954188 1:50358892-50358914 CCCGAGAGCCACACGGGGCAGGG No data
Right 906954194 1:50358915-50358937 GAGCCCCTACCCGCAGCCAAGGG No data
906954188_906954202 19 Left 906954188 1:50358892-50358914 CCCGAGAGCCACACGGGGCAGGG No data
Right 906954202 1:50358934-50358956 AGGGAGGCAGTGAGTGAGCATGG No data
906954188_906954193 -1 Left 906954188 1:50358892-50358914 CCCGAGAGCCACACGGGGCAGGG No data
Right 906954193 1:50358914-50358936 GGAGCCCCTACCCGCAGCCAAGG No data
906954188_906954196 3 Left 906954188 1:50358892-50358914 CCCGAGAGCCACACGGGGCAGGG No data
Right 906954196 1:50358918-50358940 CCCCTACCCGCAGCCAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906954188 Original CRISPR CCCTGCCCCGTGTGGCTCTC GGG (reversed) Intergenic