ID: 906954190

View in Genome Browser
Species Human (GRCh38)
Location 1:50358893-50358915
Sequence CCCCTGCCCCGTGTGGCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906954190_906954194 -1 Left 906954190 1:50358893-50358915 CCGAGAGCCACACGGGGCAGGGG No data
Right 906954194 1:50358915-50358937 GAGCCCCTACCCGCAGCCAAGGG No data
906954190_906954202 18 Left 906954190 1:50358893-50358915 CCGAGAGCCACACGGGGCAGGGG No data
Right 906954202 1:50358934-50358956 AGGGAGGCAGTGAGTGAGCATGG No data
906954190_906954196 2 Left 906954190 1:50358893-50358915 CCGAGAGCCACACGGGGCAGGGG No data
Right 906954196 1:50358918-50358940 CCCCTACCCGCAGCCAAGGGAGG No data
906954190_906954193 -2 Left 906954190 1:50358893-50358915 CCGAGAGCCACACGGGGCAGGGG No data
Right 906954193 1:50358914-50358936 GGAGCCCCTACCCGCAGCCAAGG No data
906954190_906954203 30 Left 906954190 1:50358893-50358915 CCGAGAGCCACACGGGGCAGGGG No data
Right 906954203 1:50358946-50358968 AGTGAGCATGGTACCCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906954190 Original CRISPR CCCCTGCCCCGTGTGGCTCT CGG (reversed) Intergenic