ID: 906954192

View in Genome Browser
Species Human (GRCh38)
Location 1:50358900-50358922
Sequence AGGGGCTCCCCTGCCCCGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906954192_906954203 23 Left 906954192 1:50358900-50358922 CCACACGGGGCAGGGGAGCCCCT No data
Right 906954203 1:50358946-50358968 AGTGAGCATGGTACCCAGCCAGG No data
906954192_906954196 -5 Left 906954192 1:50358900-50358922 CCACACGGGGCAGGGGAGCCCCT No data
Right 906954196 1:50358918-50358940 CCCCTACCCGCAGCCAAGGGAGG No data
906954192_906954204 24 Left 906954192 1:50358900-50358922 CCACACGGGGCAGGGGAGCCCCT No data
Right 906954204 1:50358947-50358969 GTGAGCATGGTACCCAGCCAGGG No data
906954192_906954193 -9 Left 906954192 1:50358900-50358922 CCACACGGGGCAGGGGAGCCCCT No data
Right 906954193 1:50358914-50358936 GGAGCCCCTACCCGCAGCCAAGG No data
906954192_906954202 11 Left 906954192 1:50358900-50358922 CCACACGGGGCAGGGGAGCCCCT No data
Right 906954202 1:50358934-50358956 AGGGAGGCAGTGAGTGAGCATGG No data
906954192_906954194 -8 Left 906954192 1:50358900-50358922 CCACACGGGGCAGGGGAGCCCCT No data
Right 906954194 1:50358915-50358937 GAGCCCCTACCCGCAGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906954192 Original CRISPR AGGGGCTCCCCTGCCCCGTG TGG (reversed) Intergenic