ID: 906954196

View in Genome Browser
Species Human (GRCh38)
Location 1:50358918-50358940
Sequence CCCCTACCCGCAGCCAAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906954192_906954196 -5 Left 906954192 1:50358900-50358922 CCACACGGGGCAGGGGAGCCCCT No data
Right 906954196 1:50358918-50358940 CCCCTACCCGCAGCCAAGGGAGG No data
906954188_906954196 3 Left 906954188 1:50358892-50358914 CCCGAGAGCCACACGGGGCAGGG No data
Right 906954196 1:50358918-50358940 CCCCTACCCGCAGCCAAGGGAGG No data
906954190_906954196 2 Left 906954190 1:50358893-50358915 CCGAGAGCCACACGGGGCAGGGG No data
Right 906954196 1:50358918-50358940 CCCCTACCCGCAGCCAAGGGAGG No data
906954185_906954196 7 Left 906954185 1:50358888-50358910 CCCACCCGAGAGCCACACGGGGC No data
Right 906954196 1:50358918-50358940 CCCCTACCCGCAGCCAAGGGAGG No data
906954186_906954196 6 Left 906954186 1:50358889-50358911 CCACCCGAGAGCCACACGGGGCA No data
Right 906954196 1:50358918-50358940 CCCCTACCCGCAGCCAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906954196 Original CRISPR CCCCTACCCGCAGCCAAGGG AGG Intergenic