ID: 906954202

View in Genome Browser
Species Human (GRCh38)
Location 1:50358934-50358956
Sequence AGGGAGGCAGTGAGTGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906954197_906954202 -8 Left 906954197 1:50358919-50358941 CCCTACCCGCAGCCAAGGGAGGC No data
Right 906954202 1:50358934-50358956 AGGGAGGCAGTGAGTGAGCATGG No data
906954186_906954202 22 Left 906954186 1:50358889-50358911 CCACCCGAGAGCCACACGGGGCA No data
Right 906954202 1:50358934-50358956 AGGGAGGCAGTGAGTGAGCATGG No data
906954192_906954202 11 Left 906954192 1:50358900-50358922 CCACACGGGGCAGGGGAGCCCCT No data
Right 906954202 1:50358934-50358956 AGGGAGGCAGTGAGTGAGCATGG No data
906954190_906954202 18 Left 906954190 1:50358893-50358915 CCGAGAGCCACACGGGGCAGGGG No data
Right 906954202 1:50358934-50358956 AGGGAGGCAGTGAGTGAGCATGG No data
906954195_906954202 -7 Left 906954195 1:50358918-50358940 CCCCTACCCGCAGCCAAGGGAGG No data
Right 906954202 1:50358934-50358956 AGGGAGGCAGTGAGTGAGCATGG No data
906954185_906954202 23 Left 906954185 1:50358888-50358910 CCCACCCGAGAGCCACACGGGGC No data
Right 906954202 1:50358934-50358956 AGGGAGGCAGTGAGTGAGCATGG No data
906954198_906954202 -9 Left 906954198 1:50358920-50358942 CCTACCCGCAGCCAAGGGAGGCA No data
Right 906954202 1:50358934-50358956 AGGGAGGCAGTGAGTGAGCATGG No data
906954188_906954202 19 Left 906954188 1:50358892-50358914 CCCGAGAGCCACACGGGGCAGGG No data
Right 906954202 1:50358934-50358956 AGGGAGGCAGTGAGTGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906954202 Original CRISPR AGGGAGGCAGTGAGTGAGCA TGG Intergenic