ID: 906954203

View in Genome Browser
Species Human (GRCh38)
Location 1:50358946-50358968
Sequence AGTGAGCATGGTACCCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906954199_906954203 -1 Left 906954199 1:50358924-50358946 CCCGCAGCCAAGGGAGGCAGTGA No data
Right 906954203 1:50358946-50358968 AGTGAGCATGGTACCCAGCCAGG No data
906954198_906954203 3 Left 906954198 1:50358920-50358942 CCTACCCGCAGCCAAGGGAGGCA No data
Right 906954203 1:50358946-50358968 AGTGAGCATGGTACCCAGCCAGG No data
906954195_906954203 5 Left 906954195 1:50358918-50358940 CCCCTACCCGCAGCCAAGGGAGG No data
Right 906954203 1:50358946-50358968 AGTGAGCATGGTACCCAGCCAGG No data
906954192_906954203 23 Left 906954192 1:50358900-50358922 CCACACGGGGCAGGGGAGCCCCT No data
Right 906954203 1:50358946-50358968 AGTGAGCATGGTACCCAGCCAGG No data
906954197_906954203 4 Left 906954197 1:50358919-50358941 CCCTACCCGCAGCCAAGGGAGGC No data
Right 906954203 1:50358946-50358968 AGTGAGCATGGTACCCAGCCAGG No data
906954200_906954203 -2 Left 906954200 1:50358925-50358947 CCGCAGCCAAGGGAGGCAGTGAG No data
Right 906954203 1:50358946-50358968 AGTGAGCATGGTACCCAGCCAGG No data
906954201_906954203 -8 Left 906954201 1:50358931-50358953 CCAAGGGAGGCAGTGAGTGAGCA No data
Right 906954203 1:50358946-50358968 AGTGAGCATGGTACCCAGCCAGG No data
906954190_906954203 30 Left 906954190 1:50358893-50358915 CCGAGAGCCACACGGGGCAGGGG No data
Right 906954203 1:50358946-50358968 AGTGAGCATGGTACCCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906954203 Original CRISPR AGTGAGCATGGTACCCAGCC AGG Intergenic