ID: 906955123

View in Genome Browser
Species Human (GRCh38)
Location 1:50367797-50367819
Sequence ATCTTCTTCTAGCTGTATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906955123_906955124 20 Left 906955123 1:50367797-50367819 CCTTAATACAGCTAGAAGAAGAT No data
Right 906955124 1:50367840-50367862 TGTTGTTCTCTTTGTCCTTGTGG No data
906955123_906955125 21 Left 906955123 1:50367797-50367819 CCTTAATACAGCTAGAAGAAGAT No data
Right 906955125 1:50367841-50367863 GTTGTTCTCTTTGTCCTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906955123 Original CRISPR ATCTTCTTCTAGCTGTATTA AGG (reversed) Intergenic
No off target data available for this crispr