ID: 906959955

View in Genome Browser
Species Human (GRCh38)
Location 1:50414208-50414230
Sequence TTGGGAGTAAGTAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906959955_906959966 25 Left 906959955 1:50414208-50414230 CCCTCTTCCTTACTTACTCCCAA No data
Right 906959966 1:50414256-50414278 GCTCCTAGCAGTTCTTGAAGGGG No data
906959955_906959965 24 Left 906959955 1:50414208-50414230 CCCTCTTCCTTACTTACTCCCAA No data
Right 906959965 1:50414255-50414277 GGCTCCTAGCAGTTCTTGAAGGG No data
906959955_906959964 23 Left 906959955 1:50414208-50414230 CCCTCTTCCTTACTTACTCCCAA No data
Right 906959964 1:50414254-50414276 TGGCTCCTAGCAGTTCTTGAAGG No data
906959955_906959959 -6 Left 906959955 1:50414208-50414230 CCCTCTTCCTTACTTACTCCCAA No data
Right 906959959 1:50414225-50414247 TCCCAACACTGGATCAACAGTGG No data
906959955_906959961 -5 Left 906959955 1:50414208-50414230 CCCTCTTCCTTACTTACTCCCAA No data
Right 906959961 1:50414226-50414248 CCCAACACTGGATCAACAGTGGG No data
906959955_906959963 3 Left 906959955 1:50414208-50414230 CCCTCTTCCTTACTTACTCCCAA No data
Right 906959963 1:50414234-50414256 TGGATCAACAGTGGGTAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906959955 Original CRISPR TTGGGAGTAAGTAAGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr