ID: 906959987

View in Genome Browser
Species Human (GRCh38)
Location 1:50414367-50414389
Sequence TCTGGATTTGGTAGATTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906959987_906959994 29 Left 906959987 1:50414367-50414389 CCAAATAATCTACCAAATCCAGA No data
Right 906959994 1:50414419-50414441 AGCTCTCAGTACTGAAGTCCAGG No data
906959987_906959989 -7 Left 906959987 1:50414367-50414389 CCAAATAATCTACCAAATCCAGA No data
Right 906959989 1:50414383-50414405 ATCCAGATGCAAATCTTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906959987 Original CRISPR TCTGGATTTGGTAGATTATT TGG (reversed) Intergenic