ID: 906959990 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:50414385-50414407 |
Sequence | GACCTGGTAAGATTTGCATC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
906959990_906959994 | 11 | Left | 906959990 | 1:50414385-50414407 | CCAGATGCAAATCTTACCAGGTC | No data | ||
Right | 906959994 | 1:50414419-50414441 | AGCTCTCAGTACTGAAGTCCAGG | No data | ||||
906959990_906959995 | 23 | Left | 906959990 | 1:50414385-50414407 | CCAGATGCAAATCTTACCAGGTC | No data | ||
Right | 906959995 | 1:50414431-50414453 | TGAAGTCCAGGCCCAGTTTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
906959990 | Original CRISPR | GACCTGGTAAGATTTGCATC TGG (reversed) | Intergenic | ||