ID: 906959990

View in Genome Browser
Species Human (GRCh38)
Location 1:50414385-50414407
Sequence GACCTGGTAAGATTTGCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906959990_906959994 11 Left 906959990 1:50414385-50414407 CCAGATGCAAATCTTACCAGGTC No data
Right 906959994 1:50414419-50414441 AGCTCTCAGTACTGAAGTCCAGG No data
906959990_906959995 23 Left 906959990 1:50414385-50414407 CCAGATGCAAATCTTACCAGGTC No data
Right 906959995 1:50414431-50414453 TGAAGTCCAGGCCCAGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906959990 Original CRISPR GACCTGGTAAGATTTGCATC TGG (reversed) Intergenic