ID: 906959991

View in Genome Browser
Species Human (GRCh38)
Location 1:50414401-50414423
Sequence GAGCTGTTGACAACGGGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906959991_906959995 7 Left 906959991 1:50414401-50414423 CCAGGTCCCGTTGTCAACAGCTC No data
Right 906959995 1:50414431-50414453 TGAAGTCCAGGCCCAGTTTCTGG No data
906959991_906959994 -5 Left 906959991 1:50414401-50414423 CCAGGTCCCGTTGTCAACAGCTC No data
Right 906959994 1:50414419-50414441 AGCTCTCAGTACTGAAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906959991 Original CRISPR GAGCTGTTGACAACGGGACC TGG (reversed) Intergenic
No off target data available for this crispr