ID: 906959994

View in Genome Browser
Species Human (GRCh38)
Location 1:50414419-50414441
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906959987_906959994 29 Left 906959987 1:50414367-50414389 CCAAATAATCTACCAAATCCAGA No data
Right 906959994 1:50414419-50414441 AGCTCTCAGTACTGAAGTCCAGG No data
906959988_906959994 17 Left 906959988 1:50414379-50414401 CCAAATCCAGATGCAAATCTTAC No data
Right 906959994 1:50414419-50414441 AGCTCTCAGTACTGAAGTCCAGG No data
906959991_906959994 -5 Left 906959991 1:50414401-50414423 CCAGGTCCCGTTGTCAACAGCTC No data
Right 906959994 1:50414419-50414441 AGCTCTCAGTACTGAAGTCCAGG No data
906959990_906959994 11 Left 906959990 1:50414385-50414407 CCAGATGCAAATCTTACCAGGTC No data
Right 906959994 1:50414419-50414441 AGCTCTCAGTACTGAAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type