ID: 906960530

View in Genome Browser
Species Human (GRCh38)
Location 1:50417043-50417065
Sequence CCTGGGAGTTATGGGGTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906960530_906960538 1 Left 906960530 1:50417043-50417065 CCCAGAACCCCATAACTCCCAGG 0: 1
1: 0
2: 3
3: 29
4: 206
Right 906960538 1:50417067-50417089 TGTAGCCCTTGTCAGAAGAATGG 0: 1
1: 0
2: 1
3: 9
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906960530 Original CRISPR CCTGGGAGTTATGGGGTTCT GGG (reversed) Intergenic
900136011 1:1117169-1117191 CCTGGGAGGTTGGGGGGTCTGGG - Intergenic
900350441 1:2231922-2231944 CTTGGGAGTTCTGGGCTTCAGGG + Intronic
900713005 1:4126934-4126956 CCTGGGACTAGTGGGCTTCTTGG + Intergenic
902375895 1:16029822-16029844 TCTGAGAGTTTTGGGGTTCTTGG + Intronic
902380841 1:16051569-16051591 TCTGAGAGTTTCGGGGTTCTTGG + Intronic
902690732 1:18108868-18108890 CCTGGGAGTCGTGGGCTTCATGG + Intronic
902691238 1:18110975-18110997 CCTGCGGGTTCTCGGGTTCTCGG + Intronic
903649624 1:24914699-24914721 CCTGGGGGTTGTGGGGATCTTGG + Intronic
903859789 1:26357614-26357636 CCGGGGAGCTGTGGGGCTCTCGG + Intergenic
904129898 1:28267957-28267979 CCTGGGAATTTTGGGGTCATAGG + Intronic
904827851 1:33286670-33286692 CCTGGGAGTTCTGGGCATGTGGG - Intronic
906244410 1:44262936-44262958 GCTGGAAGTGATGGGGTTCCTGG - Intronic
906393993 1:45444663-45444685 CCTGGGAGTTATTTTATTCTAGG - Intronic
906960530 1:50417043-50417065 CCTGGGAGTTATGGGGTTCTGGG - Intergenic
908220947 1:62005680-62005702 CCTGGGAGTTAGAGGCTTCTAGG + Intronic
910629353 1:89340155-89340177 CCTGGGAATTATGGGGTTTCAGG - Intergenic
913233931 1:116764351-116764373 CCTGGGAGTTATGGGGTGAAAGG + Intronic
915361694 1:155289761-155289783 GTGGGGAGTTCTGGGGTTCTTGG + Exonic
917196105 1:172467453-172467475 CGTGGGTGTCATGGGATTCTGGG - Intronic
917209451 1:172616627-172616649 CCTGGGAGTAATGGGGGTGAGGG - Intergenic
919297440 1:195720881-195720903 CCTGGGAGTTCAGGGGTGCAGGG + Intergenic
919611748 1:199753629-199753651 CCTGTGAGTATTGGGGTTCATGG + Intergenic
920002520 1:202809514-202809536 TCTGGGAGTTATGTGCTTATGGG + Intergenic
923087512 1:230712803-230712825 CCTGGGAGTAATGGTGCTCTGGG + Intronic
923497777 1:234540188-234540210 CCAGGGAGTTACGGAGTCCTGGG - Intergenic
923808751 1:237288930-237288952 CCAGGCAGGTATGGGGTGCTTGG + Intronic
1065505543 10:26426799-26426821 CCTGGGGGTCCTGGAGTTCTTGG + Intergenic
1065980959 10:30896636-30896658 TCTGGGGGATATGGGGTTGTGGG + Intronic
1068487267 10:57676181-57676203 CCTGGGAGGTATGGGATTGAAGG - Intergenic
1069831996 10:71287302-71287324 CCTGGGAGTGATGGGGGCCTGGG - Intronic
1069954548 10:72042031-72042053 CCACTGAGTTATGGGGTTTTGGG - Intergenic
1070126385 10:73625696-73625718 CCCGGGTGTAATGGGGTTCAGGG - Intronic
1070855800 10:79607204-79607226 CCTGGGAATTCTGGGGTTTGTGG + Intergenic
1072192210 10:93085280-93085302 CCTGGGACTCAAGGGTTTCTTGG + Intergenic
1072881122 10:99230896-99230918 CCTGGGAGCTATAAGGTTCTGGG + Intronic
1074208404 10:111304483-111304505 CCTGGGGGTTCTGAGGTTCTGGG + Intergenic
1074904207 10:117846800-117846822 CCAGGGAATTAAGAGGTTCTAGG + Intergenic
1075464027 10:122638055-122638077 CCTGGGAGTGAGGGGTTTCCTGG - Intronic
1076618664 10:131772962-131772984 GCTGGGAGTTAGGGGGCGCTGGG - Intergenic
1077453736 11:2665727-2665749 CCTGGGGCTTTGGGGGTTCTGGG - Intronic
1079479885 11:20868223-20868245 CTTGGGAGTCATGGAGGTCTGGG - Intronic
1081591981 11:44429728-44429750 CCTGAGAGATATGGGGTTTTGGG - Intergenic
1081804309 11:45882057-45882079 CCTGGAAGGAATGGTGTTCTGGG - Exonic
1082749322 11:57000071-57000093 CCTGGGAATTCTGGGTTTGTGGG + Intergenic
1088237882 11:107744506-107744528 TCTAGCAGTTATGGGGCTCTTGG - Intergenic
1088425735 11:109699870-109699892 CTTGGGAGTTATGTGTTTCCAGG - Intergenic
1088604174 11:111512680-111512702 CCTGGGGGTCATGGGGGTCGGGG + Intergenic
1088908134 11:114170229-114170251 CCTAGGCTTTGTGGGGTTCTAGG - Intronic
1089122478 11:116147123-116147145 CCTGGGAATTCTGGGGTTTGTGG - Intergenic
1090952145 11:131483102-131483124 ACTGGGTCATATGGGGTTCTGGG + Intronic
1092046481 12:5434551-5434573 CCTGGGAGGTGTGTGTTTCTGGG + Intronic
1092157760 12:6295428-6295450 TCTGGGAGTTCTGGGGTGCTAGG - Intergenic
1095525210 12:43117149-43117171 CCTGTGATTCAAGGGGTTCTGGG + Intergenic
1096798493 12:54093656-54093678 CCTGGGAGTTCTGAGGTTCCGGG - Intergenic
1097963898 12:65558743-65558765 ACTGGGAGTTATTAGGTGCTCGG - Intergenic
1098107587 12:67085860-67085882 CCTGGGAGTTATTTGTTTCACGG + Intergenic
1100874059 12:98943897-98943919 CCTGGGAGGTGTTGGGTTATTGG + Intronic
1101881538 12:108629270-108629292 CCTGGGAGTGAGGGGTTTCTGGG - Intronic
1102238235 12:111308152-111308174 TCTGGAATTAATGGGGTTCTGGG + Intronic
1102906090 12:116676178-116676200 CCTGGGAGGGATGGGGTTGCAGG + Intergenic
1103415606 12:120740090-120740112 CCTGTGAGTGTTGGGGGTCTTGG + Intergenic
1103841834 12:123871360-123871382 TATGGGATTTGTGGGGTTCTAGG + Intronic
1103879765 12:124157231-124157253 AGTGGGGGTTATGGGGTACTGGG + Intronic
1110440808 13:75523218-75523240 CCTGAAAGTAATGGGATTCTAGG + Intergenic
1111064192 13:83069475-83069497 CCTGGGATTCATGTGGTGCTGGG - Intergenic
1113722006 13:112565249-112565271 CTTGCGAGTTATGGTGTTGTAGG - Intronic
1114755148 14:25251180-25251202 CCTTGGAGTCATGGGTTTTTAGG + Intergenic
1120667860 14:87328496-87328518 CATGGGAGTTATGGGTTTGGGGG - Intergenic
1121311971 14:92940300-92940322 CCTGGAAGATGTGGGGTGCTGGG - Exonic
1121736269 14:96220218-96220240 CCTGAGAGTTGTGTGGTCCTGGG + Intronic
1122763574 14:104048907-104048929 CCTGGGAGTGCTGTGGTGCTGGG + Intronic
1123031629 14:105454505-105454527 CCTGGTGGTGTTGGGGTTCTGGG + Intronic
1123096675 14:105770163-105770185 ATTGGGAGTTACGGGGATCTGGG + Intergenic
1123096722 14:105770351-105770373 ATTGGGAGTTACGGGGATCTGGG + Intergenic
1123096768 14:105770539-105770561 ATTGGGAGTTACGGGGATCTGGG + Intergenic
1124370723 15:29103495-29103517 CCTGGGAGGTGTGGGGTTCAGGG - Intronic
1124723229 15:32131904-32131926 CCTGGGAGGGATGGGGACCTTGG + Intronic
1128716648 15:69913567-69913589 GCTTGGAGTGCTGGGGTTCTGGG - Intergenic
1131067316 15:89442627-89442649 CCTGGGAGATATGAGACTCTAGG + Intergenic
1131374550 15:91912883-91912905 CCTGGGAGGTAGGGGGCTTTGGG - Intronic
1134019390 16:10910963-10910985 CCTGGGACTAAGGGGCTTCTTGG - Intronic
1134094096 16:11407459-11407481 CCAGGGAGTTGTGGGTCTCTTGG - Intronic
1134254718 16:12601568-12601590 CTTGGAAGGTATGGGGTTCTGGG + Intergenic
1134765651 16:16755565-16755587 CCTGGGAGGTATTGGGATCATGG - Intergenic
1134980398 16:18603648-18603670 CCTGGGAGGTATTGGGATCATGG + Intergenic
1135395418 16:22127993-22128015 CCTGGGAATGATGGGGTCCTAGG + Intronic
1135407743 16:22210167-22210189 CCTGGGACTTTGGGGGTTGTGGG - Intronic
1136450434 16:30351667-30351689 TCTGTTAGTTATGGGGGTCTGGG - Exonic
1137628518 16:49924640-49924662 CCAGGGAGCTATGGGTGTCTGGG - Intergenic
1140440977 16:74987455-74987477 CCTGGAACTTATGGGTTTCTTGG - Intronic
1141438065 16:84012226-84012248 CCTGGGTAGTCTGGGGTTCTGGG - Intronic
1142607781 17:1091499-1091521 CCTGTGTGTTATGGGGTGCCTGG - Intronic
1143525390 17:7468922-7468944 CCAGGGACTGATGAGGTTCTGGG + Intronic
1144301372 17:13925232-13925254 CCTGGGAATTCTGGGGTTTGTGG - Intergenic
1147037358 17:37691755-37691777 CCTGGGAGTTAGGCAGATCTGGG - Intronic
1147425640 17:40344782-40344804 GTTGGGAGTGATGGGGGTCTGGG + Intronic
1147496361 17:40919958-40919980 CCTGGGACTAATGAGTTTCTGGG + Intergenic
1149956095 17:61052046-61052068 CTTGGGGTTTATGGGATTCTTGG + Intronic
1151177648 17:72301866-72301888 CCTGAGAGTTCTGGGGGACTTGG + Intergenic
1151298863 17:73206773-73206795 GCAGGATGTTATGGGGTTCTTGG - Exonic
1152027387 17:77820185-77820207 ACTTGGAGTTGTGGGGTTGTGGG - Intergenic
1152755201 17:82084340-82084362 CCTGCTAGGTATGGAGTTCTCGG - Exonic
1158610701 18:58937717-58937739 CATGGGAGTTGTAGGCTTCTAGG + Intronic
1160407275 18:78653717-78653739 CCTGGGACTGAAGGGGTTCCTGG - Intergenic
1160407895 18:78655371-78655393 CCTGGGACTGAGGGGGTTCCCGG - Intergenic
1161172404 19:2819671-2819693 CCCGGGTGTTGTGGGGTTCGCGG - Intergenic
1161981022 19:7630435-7630457 GGTGGGAGTTCTGGGATTCTTGG + Intronic
1162662646 19:12182390-12182412 CATGGAAGCTATGGGCTTCTTGG - Intronic
1163338657 19:16689929-16689951 CCTGGGAGTTAGGTGGGTCCTGG + Exonic
1166300323 19:41909030-41909052 CCTGGAGGTTCTGGGGTGCTGGG - Intronic
1166728648 19:45044838-45044860 TTTGGGAGTCATGGGGCTCTGGG + Intronic
1168056348 19:53867251-53867273 CCTGGGCTTTAGGTGGTTCTGGG - Intronic
925750288 2:7083812-7083834 CCTGGGAGTTGTGGGTCTCCTGG + Intergenic
932075218 2:68656261-68656283 ACAGGGAATTATGGGGTTCTGGG + Intergenic
932906776 2:75762163-75762185 CCTGGAATTTATGGGTTTCCGGG + Intergenic
933141022 2:78793054-78793076 CCTGGGAATTCTGGGGTTTGTGG + Intergenic
935538998 2:104327179-104327201 AGTTGGAGTTATGGGTTTCTGGG - Intergenic
938236544 2:129710735-129710757 CCTGTGAGTGATGGGGGTCCAGG - Intergenic
939988603 2:148856001-148856023 CCTGGGAGTGGTGGGGTTGAAGG - Intergenic
943890029 2:193275281-193275303 CATGTCAGTTATTGGGTTCTGGG + Intergenic
944059582 2:195558417-195558439 CCTGAGAATCTTGGGGTTCTGGG - Intergenic
946229631 2:218283285-218283307 CCTGCGAGTTCTGGGGTTCTGGG - Intronic
947977744 2:234382101-234382123 CCTGGGAGTTCAGGAGTTCAAGG - Intergenic
948582283 2:238996547-238996569 CCTGGGGGTTAGGAGGGTCTTGG + Intergenic
949028474 2:241777189-241777211 TCTGGGTGTTTGGGGGTTCTGGG + Intronic
1169046530 20:2537994-2538016 TTGGGGAGTGATGGGGTTCTGGG + Intronic
1169636405 20:7696931-7696953 CCTGGGACTGAGGGGCTTCTCGG - Intergenic
1170225332 20:13985806-13985828 CCTGGGAGGTATGGGGCAATTGG - Intronic
1171797919 20:29580683-29580705 CCTGGGAGTTCTGAGGTTCCGGG + Intergenic
1171850322 20:30303477-30303499 CCTGGGAGTTCTGAGGTTCCGGG - Intergenic
1172505237 20:35456419-35456441 CCTGGGAGTTATTGGAGGCTAGG + Intronic
1174351446 20:49971121-49971143 CCTGGCAGTGAGGGTGTTCTGGG - Intergenic
1175764753 20:61584580-61584602 CCTTGGAGGTATTGGGTGCTGGG + Intronic
1176071078 20:63226739-63226761 CCTGGCAGTCCTGGGATTCTGGG - Intergenic
1176098307 20:63353965-63353987 CCTGGGAGGTCTGTGGTCCTGGG + Intronic
1177345598 21:19864752-19864774 CCTGGGAGTTGTGTGGTACTAGG - Intergenic
1177387113 21:20422934-20422956 CCAGGGAGTTCTGGAGATCTGGG + Intergenic
1178516396 21:33251052-33251074 CCTGGGAGTCACTGGCTTCTTGG + Intronic
1179917902 21:44489758-44489780 CCTGGGAATTCTGGGGTTTGTGG - Intergenic
1180050006 21:45326768-45326790 CCCGGGAGTTAGGGGGACCTGGG - Intergenic
1183500462 22:38175718-38175740 CCTGGGTGGTGTGGGGTGCTGGG - Intronic
1184549167 22:45195349-45195371 CCTGGTTGTTCTGGGGATCTTGG - Intronic
1184650434 22:45917133-45917155 CCTGTGAGTTTTGGGGATCCAGG - Intergenic
1184885213 22:47340646-47340668 CCTAGGAATTAGGAGGTTCTAGG - Intergenic
949995454 3:9613004-9613026 CCTGGAAGTGCTGGGCTTCTAGG - Intergenic
950085019 3:10251171-10251193 TCTGGGAGTGATGAGCTTCTAGG + Intronic
950099645 3:10348933-10348955 CCTTGTGGTTCTGGGGTTCTGGG + Intronic
950808892 3:15632630-15632652 CCTGGAAGTCATGGGGTTCTTGG - Intronic
951208466 3:19947831-19947853 CCTGGCAGTCCTGGGGGTCTCGG + Intronic
953217683 3:40936626-40936648 CCAGGCAGTTCTGGAGTTCTTGG - Intergenic
954313149 3:49786009-49786031 CCTGGGAGTTATGTTGCTCCTGG - Exonic
954929985 3:54272907-54272929 CCTGGGAGGAATGGGGTCCAAGG - Intronic
956260560 3:67336012-67336034 CCAGGAAGTTGTGGGTTTCTTGG + Intergenic
956293983 3:67692290-67692312 ACTGAGAGTTATGGGAGTCTGGG - Intergenic
957469194 3:80636482-80636504 CCTGGGAGCTATGGGAGACTGGG + Intergenic
959254197 3:103989873-103989895 CCTGGGAATTCTGGGGTTTGTGG + Intergenic
961343245 3:126244472-126244494 CTTGGGAATTATGGGGTTTGTGG + Intergenic
963761537 3:149290813-149290835 CCTGGGAATTCTGGGGTTTGTGG - Intergenic
965320896 3:167250288-167250310 CCTGGGAATTTTGGGGTTTGTGG - Intronic
967763641 3:193252919-193252941 CCTGGAAGTTCTGGGGTCCCAGG + Intronic
968392672 4:205772-205794 CCTGGGGGTCCTGGGGGTCTGGG - Intergenic
969283938 4:6190782-6190804 CCTGGGAGCTCTGGCGTCCTGGG - Intronic
969941483 4:10736425-10736447 TCTGCCAGTTATGGGGTTCCTGG + Intergenic
973366026 4:49210277-49210299 GCTGGCAGGGATGGGGTTCTTGG + Intergenic
975738625 4:77406507-77406529 CATGGTAGTTATGGGGATGTGGG - Intronic
978954283 4:114595741-114595763 CATGGGAGATCTGGGGTCCTTGG - Intergenic
979935379 4:126687565-126687587 CCCGGGAGTTCTAGGGTTGTTGG - Intergenic
981547221 4:145906143-145906165 GCTGAGAGATTTGGGGTTCTTGG - Intronic
984340742 4:178453022-178453044 CCTGGGAGTTGTTGAGTCCTAGG - Intergenic
985276245 4:188240715-188240737 CCTGGGTATTTTGGGGTTGTTGG - Intergenic
985495919 5:205752-205774 CCTGAGAGATAAGGGCTTCTCGG + Exonic
986050032 5:4081439-4081461 CCTGGGTGTCATGTGGCTCTGGG - Intergenic
987083197 5:14444896-14444918 CCTGGGACCTGTGGGTTTCTTGG - Intronic
987265775 5:16253473-16253495 GGTGGGAGTTGTGGGGTTGTGGG + Intergenic
988403278 5:30790909-30790931 CCTGGGATTTATGGGTTTATCGG + Intergenic
988922946 5:35961616-35961638 CCTGGGAATTCTGGGGTTTATGG + Intronic
989173605 5:38498190-38498212 CCTAAGACTTATGGGCTTCTTGG + Intronic
992672155 5:79071157-79071179 CCTGGGAGTTAAGGTGTTAATGG + Intronic
992990834 5:82281500-82281522 CGTGGGAGTTTGGGGGATCTGGG + Intronic
994536350 5:101034785-101034807 CCCTGGAGTTATGGGGATATGGG - Intergenic
994584298 5:101685614-101685636 CCTGTGAATTATGGAATTCTGGG - Intergenic
994959398 5:106579189-106579211 CCTGAGAGATATGAGGGTCTGGG + Intergenic
994959412 5:106579279-106579301 CCTGAGAGATATGAGGGTCTGGG + Intergenic
995003911 5:107167847-107167869 CCTGGGAGTTAGGGCTGTCTAGG - Intergenic
997212828 5:132087588-132087610 CCTGGGACTTGTGGGGTTGAGGG - Intergenic
997465461 5:134084996-134085018 CCTGGGATCTCTGGGGTCCTTGG + Intergenic
997592592 5:135085089-135085111 CCTGGGTGTCATGGGTCTCTGGG + Intronic
997891766 5:137683279-137683301 CCTGGGAATTATGGGGCTTATGG - Intronic
999272691 5:150306613-150306635 CCTGGGAGTTTGGGGTTTATCGG + Intronic
999371144 5:151056175-151056197 CCTTGGAGTTATATGGTCCTTGG - Intronic
1005893015 6:30155160-30155182 CCTGGGAGTCACGGAGTTGTTGG - Intronic
1006208775 6:32375075-32375097 CCTGGGAATTCTGGGGTTTGTGG - Intergenic
1006524378 6:34591238-34591260 CCTTGGCCTTATGGGGTCCTGGG - Intronic
1009039767 6:58162283-58162305 CCTGGGAGTTAACTGGATCTAGG - Intergenic
1010728250 6:79360047-79360069 CCTTGAACTCATGGGGTTCTGGG + Intergenic
1012742876 6:103042501-103042523 TCTGGGGGTTATATGGTTCTTGG + Intergenic
1013580380 6:111528475-111528497 TCTGGGAGATATGGGGCTCAGGG + Intergenic
1016289356 6:142510915-142510937 CTTGGGAGTAATGGGGTACCGGG - Intergenic
1017521602 6:155207657-155207679 CCTTGAAGTTAAGGGGCTCTAGG + Intronic
1019042825 6:169120638-169120660 CTTGGGAGTTCTGGGGTTTGTGG - Intergenic
1024086324 7:45894512-45894534 CCTGGCAGCTATGGGGTTGGAGG - Intergenic
1027338746 7:77182880-77182902 CCTGGGAGTGGTGGGGTTGGTGG - Intronic
1027448307 7:78299964-78299986 CATGGAATTTTTGGGGTTCTGGG + Intronic
1030363559 7:108621485-108621507 CCTGGGACTTAGGGGCTTCAAGG - Intergenic
1033173752 7:139107242-139107264 GCTGGGAGTTATGGGTATCGAGG - Intronic
1035185097 7:157120276-157120298 CCTGGCAGTTGGGTGGTTCTAGG + Intergenic
1035888531 8:3320034-3320056 CATGGTAGTGATGAGGTTCTGGG - Intronic
1036418628 8:8574584-8574606 CCTGGGAGGTTTGGGGTTCAAGG - Intergenic
1038729802 8:30116628-30116650 CCTGGGGGTTGTGGGGCTCGGGG + Intronic
1039659992 8:39450773-39450795 CCTGGGAATTCTGGGGTTTGTGG - Intergenic
1041734327 8:61093965-61093987 CCTGGGAGCCATGGGGTTTTCGG + Intronic
1043469936 8:80552182-80552204 CCTGGGAATAATGGGCTTCCAGG - Intergenic
1044106039 8:88208475-88208497 TGTTGGATTTATGGGGTTCTTGG - Intronic
1046233126 8:111384085-111384107 CCTGGGATTTTTGGTGTTGTTGG + Intergenic
1047178820 8:122567804-122567826 CCTGGGGATTATGGGGATTTTGG + Intergenic
1049719171 8:144107713-144107735 CCTGGGAGCTGTTGGGCTCTGGG + Exonic
1051524390 9:18026933-18026955 CTTGGGAGTTATGTGTTTCCAGG + Intergenic
1052381200 9:27773018-27773040 CCTTGGAGTTATGTGATTCCTGG + Intergenic
1053181672 9:35976687-35976709 CCTGGGAGTAAGGGGGCACTTGG + Intergenic
1053788102 9:41666768-41666790 CCTGGGAGTTCTGAGGTTCCGGG - Intergenic
1054157031 9:61648000-61648022 CCTGGGAGTTCTGAGGTTCCGGG + Intergenic
1054176378 9:61878107-61878129 CCTGGGAGTTCTGAGGTTCCGGG - Intergenic
1054476808 9:65579008-65579030 CCTGGGAGTTCTGAGGTTCTGGG + Intergenic
1054661160 9:67702701-67702723 CCTGGGAGTTCTGAGGTTCCGGG + Intergenic
1056747057 9:89311643-89311665 CTTGGGGGTCATGGGGTCCTCGG + Intronic
1058721419 9:107768166-107768188 CCAAGGAGTTAGGGAGTTCTTGG - Intergenic
1059443652 9:114324973-114324995 CCAGGGAGGGCTGGGGTTCTAGG - Intronic
1059444852 9:114331750-114331772 CCAGGGAGGGCTGGGGTTCTAGG - Intronic
1060396663 9:123321234-123321256 CCTGGGAGACACGGGGGTCTGGG - Intergenic
1061975011 9:134063658-134063680 CCTGGGAGCTGTGGGACTCTGGG - Intronic
1062027007 9:134345175-134345197 CCTGGAGGTTATGGGCTTCAGGG + Intronic
1062451383 9:136617164-136617186 CCTGGGGGTGATGGGGGTGTGGG + Intergenic
1189324395 X:40104359-40104381 GCTGGGAGCTTTCGGGTTCTAGG - Intronic
1191693426 X:63964069-63964091 CCTAGGAGTTATGTGGCTTTGGG - Intergenic
1194263446 X:91727292-91727314 CCAGGGAGGGATGGGGGTCTAGG - Intergenic
1199142762 X:144332295-144332317 CCTGGGAATTCTGGGGTTTGTGG + Intergenic
1199586670 X:149422249-149422271 CTTGGAAGTTATGTGTTTCTAGG - Intergenic
1200397256 X:155998489-155998511 CCTGTGATTTATGCTGTTCTGGG + Intronic
1200420141 Y:2956269-2956291 CCTGGGAGTAGTGGGGTTCGGGG + Intronic