ID: 906961634

View in Genome Browser
Species Human (GRCh38)
Location 1:50422695-50422717
Sequence GGTCCCCTGGGACCCCAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 232}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906961634_906961637 -8 Left 906961634 1:50422695-50422717 CCGTCTTGGGGTCCCAGGGGACC 0: 1
1: 0
2: 1
3: 31
4: 232
Right 906961637 1:50422710-50422732 AGGGGACCCCTCTCGAGCGCAGG 0: 1
1: 0
2: 0
3: 6
4: 56
906961634_906961644 20 Left 906961634 1:50422695-50422717 CCGTCTTGGGGTCCCAGGGGACC 0: 1
1: 0
2: 1
3: 31
4: 232
Right 906961644 1:50422738-50422760 GCGTTCTGATCTCAGAGTTGGGG 0: 1
1: 0
2: 3
3: 10
4: 111
906961634_906961645 27 Left 906961634 1:50422695-50422717 CCGTCTTGGGGTCCCAGGGGACC 0: 1
1: 0
2: 1
3: 31
4: 232
Right 906961645 1:50422745-50422767 GATCTCAGAGTTGGGGTCCTAGG 0: 1
1: 0
2: 2
3: 18
4: 211
906961634_906961643 19 Left 906961634 1:50422695-50422717 CCGTCTTGGGGTCCCAGGGGACC 0: 1
1: 0
2: 1
3: 31
4: 232
Right 906961643 1:50422737-50422759 TGCGTTCTGATCTCAGAGTTGGG 0: 1
1: 0
2: 0
3: 18
4: 98
906961634_906961642 18 Left 906961634 1:50422695-50422717 CCGTCTTGGGGTCCCAGGGGACC 0: 1
1: 0
2: 1
3: 31
4: 232
Right 906961642 1:50422736-50422758 CTGCGTTCTGATCTCAGAGTTGG 0: 1
1: 0
2: 7
3: 15
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906961634 Original CRISPR GGTCCCCTGGGACCCCAAGA CGG (reversed) Intronic
900114685 1:1023467-1023489 GGTCCCCTGGGTCCCCCACTGGG + Intronic
900316973 1:2061762-2061784 GGTGGCCTGGGACCCCGAGTGGG - Intronic
900419680 1:2550477-2550499 GGTCCCCTGGGGCCCCATGCTGG + Intergenic
900425543 1:2576794-2576816 GGTCCCCTGGGGCCCCATGCTGG - Intergenic
902249040 1:15141272-15141294 GATCCCCAGCGACCCCAAAATGG + Intergenic
903283452 1:22263158-22263180 GGTCCCCTGCTGTCCCAAGAGGG + Intergenic
903810003 1:26029850-26029872 GATCCTCTGGGAGCCCCAGAGGG - Intronic
906961634 1:50422695-50422717 GGTCCCCTGGGACCCCAAGACGG - Intronic
910232027 1:84997218-84997240 AGTCCCCTAGGACCCCAACTGGG - Intergenic
910845677 1:91602486-91602508 GCTCCCCTGGGGCCCAACGAGGG + Intergenic
912664886 1:111570043-111570065 TGTCCCCTGGGACATTAAGAAGG - Intronic
912831239 1:112955957-112955979 GGTCCCCTCCGACCCCACCAGGG + Exonic
913501093 1:119473395-119473417 GGCCCTGTGGGGCCCCAAGAAGG + Intergenic
915470277 1:156121773-156121795 AGTACACTGGGACCCCAAGGAGG - Intronic
915532095 1:156508625-156508647 GCTCTCCTGGGTCCCCAAGTAGG - Intergenic
916498232 1:165364688-165364710 GGTGCCCTGGTACCACCAGAAGG - Intergenic
916787437 1:168096745-168096767 GGTCACCTGGGGCCCCTACATGG - Exonic
918309501 1:183275604-183275626 GGTGTCCTGGGACTCCAGGATGG + Intronic
1064256583 10:13747680-13747702 TGTCCCCTCGCACCCCGAGAGGG + Intronic
1064370949 10:14751154-14751176 GCTCCCCTGGGACCCTAATGAGG - Intronic
1066488469 10:35871877-35871899 GGTTTCCTGGGATCCCCAGAGGG + Intergenic
1067439431 10:46300340-46300362 GGTCTCCAGGGAGCCCAGGAAGG + Intronic
1069547331 10:69338146-69338168 GGCCCCCTTGGTCCACAAGAAGG + Intronic
1069814726 10:71186597-71186619 GGTCGCATGGTCCCCCAAGAAGG - Intergenic
1070628987 10:78070933-78070955 GCATCCCTGTGACCCCAAGATGG - Intergenic
1070821262 10:79356091-79356113 GGTAAACTGAGACCCCAAGAGGG + Intergenic
1074757207 10:116632891-116632913 GCTGCCCTGGGACCCCATAATGG - Intronic
1074986475 10:118664317-118664339 TGTCTCCTGGCACCCCAAGGAGG + Intergenic
1076868693 10:133182195-133182217 GGTCACCTTGGACCTCACGACGG + Intronic
1077049144 11:558940-558962 GGTCACCTGGGACCTCCAGCAGG - Exonic
1077161816 11:1116951-1116973 CGGCCACTGGGACCCCAGGAAGG + Intergenic
1077184526 11:1230261-1230283 GGAGCCCTGGGTCCCCATGATGG + Intronic
1077462050 11:2715581-2715603 GGTCCCAGGGGACCCCAGCAGGG - Intronic
1077492571 11:2868917-2868939 GGTGCTCTGGGGCCCCAAGGAGG - Intergenic
1078084582 11:8225959-8225981 GGTCCCCAGGGACTCCCACAGGG + Intronic
1079031568 11:16990058-16990080 GGTCCCTGGTGACACCAAGAAGG + Intronic
1079110955 11:17604961-17604983 TGTCCCCTGTGTCCCCAGGAGGG - Intronic
1080118668 11:28649013-28649035 GGCCCCCTGGAACGCCAAGCTGG - Intergenic
1081807585 11:45898952-45898974 GCTCCTCTGAGCCCCCAAGAGGG + Intronic
1081877063 11:46415810-46415832 GTTCCCCAGGCAGCCCAAGATGG + Intronic
1082028600 11:47589537-47589559 GGTCCCCTTGGACCCTGGGAGGG - Intergenic
1083372343 11:62192374-62192396 GGTCACCTGGGACCACAGGGTGG + Intronic
1083627671 11:64079811-64079833 GGACCACTTGGACCCCAGGAAGG + Intronic
1084304437 11:68272231-68272253 CGCACCCCGGGACCCCAAGACGG - Intergenic
1084588849 11:70078794-70078816 GGCCTCCTGGGACCCCAGGGCGG + Intronic
1084938834 11:72601524-72601546 GGGCCCTGGGGACCCCAAAATGG + Intronic
1091591704 12:1846459-1846481 GGACCCCTGGGAGCCCAGCAGGG - Intronic
1092024292 12:5227919-5227941 GGTGCCCTGGAACCCCCGGAAGG - Intergenic
1094361974 12:29640415-29640437 GGTCTCCTGGGTCCTTAAGAGGG - Intronic
1094833798 12:34312879-34312901 GGATCCCTGGGGCCCCATGAAGG + Intergenic
1096231320 12:49898343-49898365 GGTCCCCAGGGAGCCCCAGCCGG - Intronic
1096387419 12:51204101-51204123 GCTCCCCAGGGACCACAGGAGGG + Intronic
1096865720 12:54561516-54561538 GAGCCCCAGGGCCCCCAAGAGGG - Intronic
1097174330 12:57134085-57134107 GGTCCCCAGGGCCACCAAGCTGG - Intronic
1097237169 12:57548516-57548538 GGTCCCCAGGGGCTCCAAGGTGG - Intergenic
1100391717 12:94149997-94150019 GGTCAGCTGGGACTTCAAGACGG + Exonic
1103807506 12:123584744-123584766 GGTCACCTCGGGCACCAAGATGG + Exonic
1104855539 12:131900784-131900806 GGTCTCCCAGGACCCCAAGCAGG - Intronic
1105067214 12:133210949-133210971 GGTTCACTGGGACTGCAAGAGGG - Exonic
1108855311 13:54786249-54786271 GGTTCCCTGGGAGCCCAAGCAGG - Intergenic
1109395607 13:61754568-61754590 GGTACCCAGGGACACAAAGACGG - Intergenic
1113009737 13:105750285-105750307 GGACACCTGGGACCACCAGAAGG + Intergenic
1113698241 13:112364187-112364209 TCTCCCCTGGGACCCAAACATGG + Intergenic
1114055552 14:18964836-18964858 GGTGCCCTGGGACACAAAGCTGG + Intergenic
1114106994 14:19436927-19436949 GGTGCCCTGGGACACAAAGCTGG - Intergenic
1117789370 14:59323147-59323169 GGTTCCCGGGGGCCACAAGAAGG + Exonic
1123139571 14:106062077-106062099 GGTCCCTTGGGACCACCAGGGGG - Intergenic
1123187895 14:106537738-106537760 GGTCCCTTGGGACCACCAGGGGG - Intergenic
1202909012 14_GL000194v1_random:100205-100227 ACTCCCCTGAGACCCCATGATGG + Intergenic
1202884246 14_KI270722v1_random:89024-89046 ACTCCCCTGAGACCCCATGATGG - Intergenic
1125550059 15:40538419-40538441 GGTGCCCTGTGACCCCTTGAGGG - Intronic
1125626882 15:41116140-41116162 CGGCTCCTGGGACCCCAAGATGG + Exonic
1128223738 15:65987095-65987117 GTGCCCCTGGGTCCCCAAGAGGG + Intronic
1128727436 15:69998648-69998670 GCTCCCCTTGGGCCCCATGATGG + Intergenic
1129516631 15:76161310-76161332 GGGGCTCTGGGACCCCGAGACGG + Intronic
1129675835 15:77632204-77632226 GGTGCCCTGCAACCCCAGGAGGG + Intronic
1129984712 15:79908027-79908049 GGTGCCCTGGTAGCCCAAAAGGG - Intronic
1130059062 15:80556583-80556605 GATGACCTGGGAGCCCAAGAGGG + Intronic
1130546112 15:84858346-84858368 GGTCCCCAGGGACTCCAGGGCGG + Exonic
1131076518 15:89498725-89498747 GATACCCTGGTACCCCAAGCTGG - Intergenic
1132571799 16:647479-647501 GGTCTCCTGGGTCCCCTCGAAGG - Exonic
1132598208 16:762703-762725 GGTCCCACAGGACCCCAACAGGG - Exonic
1133941949 16:10316760-10316782 GGTCCCATGGGAAGCCAAGCTGG + Intergenic
1136177581 16:28528521-28528543 GCTCCCCTGGGACTCCCTGAAGG + Intergenic
1137628790 16:49927657-49927679 GGTCCACTGGGACCTCAGTAGGG + Intergenic
1137913421 16:52402930-52402952 GGTCCCATGGGGCTCAAAGAGGG - Intergenic
1138698239 16:58835591-58835613 GGTCCTCAGGGACCCAAAGATGG - Intergenic
1139752974 16:69120325-69120347 GGTTCCCTGGGACCACAGGGGGG - Exonic
1141459321 16:84168126-84168148 TCTCCCCTGGGGCCCCCAGAAGG - Intronic
1141649494 16:85385495-85385517 GCTCCCCAGGGCCCCCGAGAAGG - Intergenic
1142882787 17:2894570-2894592 GGGCCCCTGGGACACCCAAATGG - Intronic
1143183763 17:4998781-4998803 GGTCCACTGGGGCCACAGGAGGG + Intronic
1143402379 17:6655000-6655022 GGTGCCCCGGGACCGCAAGAGGG - Intergenic
1143893717 17:10120941-10120963 GGCCCACTGGAACCCCAAGGTGG + Intronic
1144855068 17:18262968-18262990 GGTGCCCTGGGCTCCCATGAAGG - Intronic
1146492642 17:33293197-33293219 GTTCGCCTGGGGCCCAAAGAGGG - Intronic
1147915592 17:43883398-43883420 GGAGCCCTGGGACACCAAGCAGG + Intronic
1148342048 17:46878996-46879018 AGTCCCCAGGGGCCCCAAGAGGG - Intronic
1148774656 17:50088565-50088587 GGTGACTTGGGACCCCATGAGGG + Intronic
1148862150 17:50610034-50610056 GGTCCCTGGGGCCCCCAAGAGGG + Intronic
1149654340 17:58302403-58302425 GGTCCCCAGGGCCCCCAGGTGGG - Exonic
1150472257 17:65447147-65447169 GGTGACCTAGGAGCCCAAGAAGG + Intergenic
1150484719 17:65535917-65535939 GCCCCCCTGGGAGCCCAGGATGG + Intronic
1151955269 17:77376915-77376937 GGTGCCCTCGGTCCCCAAGACGG - Intronic
1151977027 17:77488916-77488938 TGTCCCCTGGGACTGCAAGACGG + Intronic
1152014913 17:77744280-77744302 AGGCCCCAGGGACCCCATGAGGG - Intergenic
1152191551 17:78891328-78891350 GTGGCGCTGGGACCCCAAGAGGG - Exonic
1152427385 17:80225681-80225703 GGACCCCTGAGCCCCTAAGATGG + Intronic
1152586181 17:81190469-81190491 GGTCTCCTGGGCCCCAAACATGG + Intronic
1152751447 17:82064305-82064327 GGTCCAGTGTGACCCCATGAGGG + Intronic
1203162153 17_GL000205v2_random:62775-62797 GGTTCCCTGGGACCCAGAGCAGG + Intergenic
1157626117 18:49052634-49052656 GGGGCCCTGGGCCACCAAGAGGG - Intronic
1160411002 18:78675415-78675437 GGTCCCCTGGCACACCCCGATGG + Intergenic
1160792330 19:928442-928464 GGTCCTCTGGGATCCCGAGTGGG - Intronic
1160928574 19:1558932-1558954 GGATGTCTGGGACCCCAAGAAGG - Intronic
1161015270 19:1980053-1980075 GGTGCCCTGGGTCCCCATGGGGG + Intronic
1161362051 19:3855936-3855958 TGTCCCCTGAGACCCCACGGGGG + Intronic
1161843142 19:6694395-6694417 GGTCCCTGGGGTCTCCAAGAGGG + Intronic
1162069975 19:8147603-8147625 GGGCCTCTGGGAGCCCAAGGAGG + Intronic
1162106743 19:8374289-8374311 GGTCCCCTGGGGACACAAGCAGG + Exonic
1162326573 19:10003136-10003158 TGTCCCCAGTGACCCCAAGCAGG + Intronic
1162403175 19:10458141-10458163 GGTCTCCTGGGACCCTGAGAAGG + Intronic
1163371443 19:16903466-16903488 GAACCCCAGGGACCCCCAGAGGG - Intronic
1163575611 19:18109535-18109557 GGTCCACCGGGGCCTCAAGAGGG + Intronic
1163581962 19:18144560-18144582 GGTCTCTTGGGCCCCCAAGGCGG - Exonic
1164647841 19:29872663-29872685 GGTGCCCGGGGACCTCTAGAGGG - Intergenic
1164857870 19:31538964-31538986 GGTCCCTAGGGTCCCCCAGAAGG - Intergenic
1165213627 19:34254412-34254434 GGGACCCTGGGCCCCCAAGCGGG - Intergenic
1165446298 19:35858576-35858598 TGTCCCCTGGGAGCCCAAGAGGG + Intronic
1167125302 19:47545019-47545041 TGACCCCTGCGCCCCCAAGAAGG - Exonic
1167249748 19:48393595-48393617 GGTCCCCAGGGAGGCCAGGAGGG + Intergenic
1167623196 19:50569864-50569886 GGTCCCCTGGCACTGAAAGAAGG - Intergenic
1168102338 19:54147997-54148019 GGTCACCCAGGTCCCCAAGAGGG + Intronic
1168156901 19:54478851-54478873 TCTCCACTGGGACCACAAGAGGG + Intergenic
1202659663 1_KI270708v1_random:56154-56176 ACTCCCCTGAGACCCCATGATGG - Intergenic
930401941 2:50901167-50901189 GTTCCCCTGAGCCCACAAGAGGG + Intronic
932054950 2:68433781-68433803 TGTGCCCTGTGTCCCCAAGACGG - Intergenic
932450912 2:71810333-71810355 GGACCCCTGGGAGCCCATGGGGG - Intergenic
933270866 2:80231503-80231525 GGTTCTCTGGGACCTGAAGAGGG - Intronic
934765691 2:96878872-96878894 TGTTCCCTGGGACACCAAAACGG + Intronic
935434002 2:103008619-103008641 GGTTTCCTGGGAGCCCGAGATGG - Intergenic
936007991 2:108907044-108907066 GGTCTACAGGGAGCCCAAGAGGG + Intronic
937450032 2:121994264-121994286 GGAGCCCTGGGACCCTAAGATGG - Intergenic
938320099 2:130356582-130356604 TGTCCCCTGTGACCACAGGAAGG + Intronic
941988767 2:171534297-171534319 GGTCCCCTAAGCCCACAAGAAGG - Intronic
942384062 2:175422894-175422916 TCTCCCCTGGAACCCCTAGAAGG - Intergenic
947758698 2:232587932-232587954 TGTCCCCTGTGAGCCCAAGAAGG + Intergenic
1168906389 20:1407385-1407407 TGTCCCCTAGGACCCCCAGAGGG + Intergenic
1170572244 20:17638962-17638984 GGCCCTCTGGGACCCTCAGAGGG - Intronic
1171481551 20:25459176-25459198 ACTCACCTGAGACCCCAAGACGG + Intronic
1171567558 20:26208929-26208951 GGGCCCCTCGGGCCCCACGAGGG - Intergenic
1172208596 20:33181892-33181914 GCTCCAGTGGGACCCCTAGAGGG - Intergenic
1172694787 20:36815171-36815193 GAGCCCCTGGGAGCCCAAGGGGG + Exonic
1172882910 20:38213300-38213322 GGCCTCCTGGGCCCCCCAGAGGG - Exonic
1173124811 20:40326890-40326912 GATCTCCGGGGACCCCAGGATGG - Intergenic
1173463197 20:43260477-43260499 GGTGGCCTGGTACCCCAAGATGG - Intergenic
1176231864 20:64037010-64037032 CTTCCCCTGGGCCCCCAGGATGG - Intronic
1176265335 20:64206322-64206344 GGTGCCCGGGGAGGCCAAGAGGG + Intronic
1176628372 21:9114917-9114939 ACTCCCCTGAGACCCCATGATGG + Intergenic
1177338115 21:19760024-19760046 GGTCCCCGGGGTCCCAGAGATGG - Intergenic
1179334938 21:40441824-40441846 TGTGCCATGGGACCCCATGATGG + Intronic
1180327132 22:11439716-11439738 ACTCCCCTGAGACCCCATGATGG - Intergenic
1180474029 22:15687388-15687410 GGTGCCCTGGGACACAAAGCTGG + Intergenic
1180929467 22:19579163-19579185 GGCCCCTTGAGACCCCAGGAGGG - Intergenic
1181389311 22:22568177-22568199 TCTCCCCTGGGACCTCCAGAAGG + Intergenic
1181931853 22:26408268-26408290 GGTCCCCTGGGGTCCCCAGAGGG - Intergenic
1182146898 22:28002088-28002110 GGTCCCCTGACATCCCCAGAGGG - Intronic
1182480785 22:30607358-30607380 GGGCCCCCAGGACCCCCAGAAGG - Exonic
1183538988 22:38418819-38418841 GGTGCTCAGGGACCCCAGGATGG - Intergenic
1183667101 22:39252449-39252471 GGTCCCCTGGTGCCCCAAGGGGG - Intergenic
1184090026 22:42288058-42288080 GTTCTCCTGGGAGCTCAAGAGGG - Intronic
1184779166 22:46637743-46637765 GGTGCCCAGGGGCCCCAGGATGG - Intronic
1185173084 22:49304752-49304774 GCTCCCAAGGGACCCCAAGAAGG + Intergenic
949681529 3:6519934-6519956 GGGCCACTGGGACCCCTGGAGGG - Intergenic
950433206 3:12963360-12963382 GAGCAGCTGGGACCCCAAGAAGG + Intronic
951220729 3:20066371-20066393 GTTCCCCTGGAACCTCAAAATGG - Intronic
953069971 3:39509841-39509863 GTTCCCCAGGGACCCCCAGCAGG + Intronic
955944613 3:64180778-64180800 GGTACCTTGGGAGGCCAAGATGG - Intronic
956622315 3:71233730-71233752 GATTCCTGGGGACCCCAAGAAGG + Intronic
960545514 3:118910236-118910258 GGTCTCCTGGGACCTCTATATGG - Intronic
961469281 3:127101231-127101253 GGTCCTGTGGGACTGCAAGATGG - Intergenic
962372558 3:134833160-134833182 AGTCCCATGGGACCCCAGGATGG - Intronic
962754396 3:138457030-138457052 AGTCCTCTGTGACCCCACGATGG - Intronic
963107731 3:141660684-141660706 TGTCCCCTGGGACTCCGAGGTGG + Intergenic
964949471 3:162271234-162271256 GGTCACCTGGAACCTCCAGAGGG + Intergenic
967747901 3:193080769-193080791 GGACCCCTGGTACCACAGGAAGG - Intergenic
967941334 3:194768807-194768829 GGTCCACGGTGACCCCAAGGAGG + Intergenic
968620822 4:1602798-1602820 GGTCCACTAGGGCCCCAGGAGGG + Intergenic
968919408 4:3514978-3515000 GTTCACCCGGGACCACAAGATGG - Intronic
968984828 4:3869429-3869451 GAACACCTGGGGCCCCAAGAGGG - Intergenic
969345000 4:6564575-6564597 AGGCAGCTGGGACCCCAAGAGGG - Intergenic
969614500 4:8244492-8244514 AGTCTCCAGGGACCCCAACAAGG - Intergenic
970585507 4:17511103-17511125 GTTCCCCTGGGACCAGAAAAAGG - Intronic
985720336 5:1485577-1485599 GGACCCCTGAGGCCCCCAGAAGG + Intronic
989480601 5:41925725-41925747 GGTCCCCAGGGGCCCCATGAAGG - Intronic
992000824 5:72434614-72434636 GGTCCCCAGGGACCCCATAAGGG + Intergenic
992204873 5:74421514-74421536 GGTCCCCTGGAGCCCTAAGCTGG + Intergenic
995446075 5:112245677-112245699 GGTCCCATGGGACACCTAGAGGG + Intronic
996619154 5:125479052-125479074 ACCCCCCTGGGATCCCAAGAGGG + Intergenic
997295275 5:132764947-132764969 GGTTCCCTGGGACTCCCAGAAGG - Intronic
999318040 5:150596697-150596719 GGGACCCAGGGACCTCAAGAAGG - Intergenic
999640940 5:153672703-153672725 GGTATCCTAGGATCCCAAGAGGG + Intronic
1000318918 5:160118755-160118777 GGTCCGCTGGGTCCCCAGGGAGG - Intronic
1000329500 5:160195920-160195942 GGTGCCCTCGGGTCCCAAGAGGG - Intronic
1001998797 5:176183588-176183610 GGTCTACTTGGTCCCCAAGATGG + Intergenic
1002074426 5:176699595-176699617 GGTCCTCTGGGAGCCATAGAGGG + Intergenic
1002530350 5:179840871-179840893 GGTCGCCTGGGGACCCCAGAAGG - Exonic
1005994985 6:30925589-30925611 GGTGCCCAGGGGCTCCAAGAAGG - Exonic
1006300809 6:33192753-33192775 GGGGCTCTGGGCCCCCAAGAGGG - Intergenic
1006592792 6:35170434-35170456 GGTCCCCTGGGGCCCCCAGCAGG - Intergenic
1006725670 6:36197296-36197318 GGTCCCCTGGGTCCCTCTGACGG + Intronic
1006801192 6:36760653-36760675 GGTGCCCTGAGCCCCCATGATGG + Intronic
1007339846 6:41184310-41184332 GATCCCCTGGGAGCCCCAAATGG - Intergenic
1010900909 6:81426130-81426152 AGTCCCCTTGGCCACCAAGAAGG - Intergenic
1011194384 6:84766624-84766646 GGCTCTCGGGGACCCCAAGAAGG + Intergenic
1011320098 6:86081192-86081214 GGTCCCCTGAGACCCTCTGAAGG - Intergenic
1012006076 6:93715310-93715332 ATCCCCCTTGGACCCCAAGAAGG - Intergenic
1019329365 7:455122-455144 GGTGCCCTGGGGACCCAGGAGGG + Intergenic
1019500329 7:1361299-1361321 GGTGACCTGGGGCCCCAGGAGGG + Intergenic
1019738209 7:2660675-2660697 GCCCTCCTGGGACACCAAGAAGG - Intronic
1021135912 7:16964947-16964969 GATTCCCTGGCACCCCAACATGG - Intergenic
1021530083 7:21634613-21634635 AGTCCCCTTGGACACAAAGAAGG + Intronic
1023243828 7:38178753-38178775 GGCGCCATGGGCCCCCAAGAAGG + Intronic
1023862431 7:44224639-44224661 GGACTCCTGGGACCCCAGGCTGG + Intronic
1025812676 7:64885096-64885118 GGTCCCCTGGTCCACCAAGAGGG - Intronic
1027144296 7:75683361-75683383 GGTCCCTTGTGACCCCAAAAGGG + Intronic
1034162131 7:149001629-149001651 GGGGCCATGGGAACCCAAGAGGG - Intergenic
1035755634 8:2029053-2029075 GCTCCCCAGGGACCCCAAAGAGG - Intergenic
1036972425 8:13369812-13369834 GGTCCACTTGAACCCCAAGTCGG + Intronic
1037899071 8:22677000-22677022 GGTCCTCTGGGATGGCAAGAAGG - Intergenic
1041213858 8:55580388-55580410 TCTCCCCTGGAACCCCCAGAAGG - Intergenic
1044551464 8:93517248-93517270 GTTTGCCTGGGACCCCAAAAAGG - Intergenic
1047203831 8:122787680-122787702 TGGCCCCTGGGCCCCCAACAGGG - Intronic
1048311417 8:133325179-133325201 GTTACCCTGGGTCCCCAGGATGG + Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1050063007 9:1730066-1730088 GGCCCTCTGGGACCCCAACCAGG + Intergenic
1051665558 9:19464674-19464696 TGTCCGCTGGGACCACAGGAAGG + Intergenic
1052988551 9:34505217-34505239 GCTCCCCTGGAGCCTCAAGAGGG - Intronic
1053128093 9:35599123-35599145 GGCCTTCTGGGGCCCCAAGAGGG - Intergenic
1057212213 9:93206435-93206457 GGTCTCCTGGGTCCCCAGGCAGG - Intronic
1057953120 9:99385801-99385823 GGTCCCCAGGGTCCCCAGGCTGG - Intergenic
1059096533 9:111422071-111422093 GTTCCCCTGGGAACCCAACAAGG - Intronic
1059398842 9:114055940-114055962 GGTACACAGGGTCCCCAAGATGG - Exonic
1060402007 9:123354806-123354828 GGTCCCCAGGGACCAAAGGAGGG - Intergenic
1060828711 9:126700743-126700765 GCTCCCATGGGACCCCCAGGTGG - Exonic
1061014458 9:127973813-127973835 GGTCCCCTGGGTGCCGTAGAAGG - Intronic
1061131857 9:128712970-128712992 GGTGTCCTGGGACCCCAGGAAGG - Intronic
1062081580 9:134626798-134626820 GGAACCCTGGGCCCCCAGGAGGG + Intergenic
1203751217 Un_GL000218v1:82600-82622 ACTCCCCTGAGACCCCATGATGG + Intergenic
1203482769 Un_GL000224v1:21754-21776 ACTCCCCTGAGACCCCATGATGG - Intergenic
1185562364 X:1069580-1069602 TGGTCCCTGGGACCCCAGGATGG + Intergenic
1185782597 X:2862238-2862260 TCTCCCCTAGGTCCCCAAGAAGG + Intronic
1186635959 X:11405232-11405254 GGTCACCTGGGACCTCAAGGTGG - Intronic
1196031542 X:111098794-111098816 GGTCCCCAGGGATCCTGAGAAGG - Intronic
1197941613 X:131795863-131795885 GGTCTCCTGGGTCCCCTGGAGGG + Intergenic
1198392732 X:136192692-136192714 GCACCCCTGGAACCCCAAGAGGG - Intronic
1200119729 X:153784607-153784629 GGTCCCCAGGTCCTCCAAGAGGG - Intronic
1200133706 X:153864630-153864652 CGTCTCCTGGGTCCCCAAGGAGG - Exonic
1201164870 Y:11200208-11200230 ACTCCCCTGAGACCCCATGATGG + Intergenic
1201770782 Y:17615077-17615099 AGTCCCCTGTGGCCACAAGATGG - Intergenic
1201830773 Y:18290909-18290931 AGTCCCCTGTGGCCACAAGATGG + Intergenic
1202162397 Y:21948877-21948899 GGTCCCTTGGGACCTAAATAGGG + Intergenic
1202228959 Y:22637496-22637518 GGTCCCTTGGGACCTAAATAGGG - Intergenic
1202314195 Y:23558669-23558691 GGTCCCTTGGGACCTAAATAGGG + Intergenic
1202556607 Y:26111926-26111948 GGTCCCTTGGGACCTAAATAGGG - Intergenic