ID: 906964798

View in Genome Browser
Species Human (GRCh38)
Location 1:50445705-50445727
Sequence TGGGACTCCTTGGGGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 320}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906964798 Original CRISPR TGGGACTCCTTGGGGGAGAA GGG Intronic
900637327 1:3672367-3672389 TGTGATCCCTTGGGGTAGAAAGG + Intronic
901838571 1:11939476-11939498 TGGGACTGCTTGGGGAGGAGGGG + Intronic
903187931 1:21639849-21639871 TGTGACTCTGTGGGTGAGAATGG + Intronic
903867273 1:26409102-26409124 TGGGACTTCGTGGGGTAAAAAGG - Intergenic
904763815 1:32826175-32826197 TGGGATTCCTTGGATGAGGATGG + Exonic
906642381 1:47449286-47449308 TGTACCTCCTTTGGGGAGAAGGG + Intergenic
906964798 1:50445705-50445727 TGGGACTCCTTGGGGGAGAAGGG + Intronic
907257638 1:53191797-53191819 AAGGATTCCTTGGAGGAGAAGGG - Intergenic
908533562 1:65056521-65056543 TGGGACACAATGGGGAAGAAAGG - Intergenic
910153242 1:84180406-84180428 TGGCACTTGGTGGGGGAGAATGG + Intronic
911167601 1:94738105-94738127 GGGGACTAATTGAGGGAGAAGGG - Intergenic
915471157 1:156126543-156126565 TGGGGCTGTTTGGGGAAGAAAGG - Intronic
915571382 1:156747058-156747080 TGGGCCTTCCTGGGGGGGAAGGG - Intronic
915873612 1:159588423-159588445 TGGGACACCTTTGGTGAAAAAGG + Exonic
915939495 1:160109742-160109764 TGGGTATCTTTGGGGGAGGAAGG - Intergenic
916518643 1:165543827-165543849 TGGAACTCCCTGGGGGAGTTGGG - Intergenic
916769461 1:167894072-167894094 TGGGACACCTAGGGGCTGAAAGG + Intronic
917018961 1:170565585-170565607 TGGAATTCTTTGGGGGTGAAAGG - Intergenic
917142889 1:171855035-171855057 GGGGCCTCCTTGAGGGTGAAGGG - Intronic
918047716 1:180951543-180951565 TGGGACTCTTTGGGAGTGGATGG + Exonic
918307625 1:183261389-183261411 TGGGGCTCCATGTGGAAGAATGG - Intronic
918774309 1:188609361-188609383 TAGGTCTCCTTGGGGAAGGATGG - Intergenic
918814902 1:189169852-189169874 TAGGTCTCCTTGGGGAAAAATGG - Intergenic
920747452 1:208642613-208642635 TGGGCCTCCTTGGGTCAGAGTGG - Intergenic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
921612975 1:217233951-217233973 TGGTAGTCCTAGGGGGAAAATGG + Intergenic
922640110 1:227221775-227221797 TGGCTTACCTTGGGGGAGAATGG - Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924587473 1:245372521-245372543 TGGGCCTACTTGGGGGTGGAGGG - Intronic
1062925533 10:1313201-1313223 GGGGACAGCTTTGGGGAGAAGGG + Intronic
1064838421 10:19561782-19561804 TAGTTCTCCATGGGGGAGAAGGG - Intronic
1065795013 10:29298662-29298684 AGGGACTCGATGAGGGAGAAAGG + Intronic
1065947879 10:30624006-30624028 AGGGACTCGATGAGGGAGAAAGG - Intronic
1068734186 10:60393279-60393301 TGAGACTCTTTGGGGCAGTATGG - Intronic
1069238435 10:66107634-66107656 TTGAACTCCTTGTGGGAAAAAGG - Intronic
1069326865 10:67241728-67241750 TAGAACTCCTTGTGGAAGAATGG - Intronic
1071512034 10:86268096-86268118 TGGGGCTGCTTGGTGGAGAGGGG - Intronic
1071560727 10:86645120-86645142 GGGGACTCCTTGGGAGACCAAGG - Intergenic
1075700744 10:124468056-124468078 TTGGAATCCTTCAGGGAGAAGGG + Intronic
1075850822 10:125585451-125585473 TGACAGGCCTTGGGGGAGAAAGG - Intronic
1076330082 10:129657729-129657751 TGTGGGTCCTTGGGGGAGAGGGG - Intronic
1076858149 10:133127511-133127533 TTGGACTCCCTGGGAGAGGAGGG - Intronic
1077072323 11:681081-681103 TGGGCCACTCTGGGGGAGAAAGG + Exonic
1077498882 11:2900010-2900032 TGGGACTCCTGGGGGAGGATGGG - Intronic
1079923890 11:26468078-26468100 TGTGGCTCCTTGGTGGAGAGAGG - Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1080959300 11:37139569-37139591 GGGGACTACTAGAGGGAGAAGGG + Intergenic
1081487911 11:43546296-43546318 CGACACTCCTTGGGGAAGAAAGG - Intergenic
1081842216 11:46210872-46210894 GGGGACTACTAGGGGGAGGAGGG - Intergenic
1082029663 11:47594966-47594988 GGAGAGTCCTTGGGGCAGAATGG + Intergenic
1082795221 11:57374098-57374120 GGGGTCTCCTTGAGGGTGAAGGG + Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1084637186 11:70399669-70399691 TGGAAGGCCTTGGGTGAGAAGGG + Intronic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1085470530 11:76754521-76754543 GGGGACTGATTGGGGGAGGATGG - Intergenic
1089215301 11:116831106-116831128 TAGGACTGCTCCGGGGAGAAAGG - Intronic
1090351577 11:126111567-126111589 CGGGACTGCTTGGAGGAGAGAGG - Intergenic
1091163395 11:133447523-133447545 GGGAAGTCATTGGGGGAGAAGGG - Intronic
1092191680 12:6526006-6526028 TTGGACTCATCGGGGGAGAAAGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094650413 12:32370489-32370511 TGGGGGTGCTTGGTGGAGAATGG - Intronic
1096521749 12:52188419-52188441 TGGAACTCCTGGAGGGAGACAGG + Intronic
1098749647 12:74278080-74278102 CAGGTCTCCTTGGGGAAGAATGG - Intergenic
1098938369 12:76506221-76506243 TGGGAAGACTTGGGGAAGAAAGG + Intronic
1099400260 12:82194837-82194859 TGGGTCTCCTTGGGAAAGGATGG - Intergenic
1099401313 12:82206119-82206141 CGGGTCTCCTTGGGGAAGGATGG + Intergenic
1099859589 12:88210036-88210058 AAGGTCTCCTTGGGGAAGAATGG + Intergenic
1101824608 12:108210355-108210377 TGGGACTCTTTGGTGGGCAAGGG - Intronic
1102738323 12:115182877-115182899 TGGGACTCAATGGAGAAGAATGG - Intergenic
1102802564 12:115749393-115749415 TGGAAGTAATTGGGGGAGAAAGG - Intergenic
1104214209 12:126720189-126720211 TTGTAATACTTGGGGGAGAAGGG - Intergenic
1106101581 13:26698070-26698092 TGGGTAGCCTTGGGGGAAAATGG - Intergenic
1106802582 13:33271426-33271448 CGGGAAAACTTGGGGGAGAATGG + Intronic
1108458447 13:50641024-50641046 GGGGACTTCTAGAGGGAGAAGGG - Intronic
1109291046 13:60475243-60475265 GGGGACTGCTTAAGGGAGAAGGG - Intronic
1109813812 13:67551905-67551927 TGGGCCTCCTTGAGGGTGAAGGG + Intergenic
1111440896 13:88281715-88281737 GAGGTCTCCTTGGGGAAGAATGG - Intergenic
1111586403 13:90289088-90289110 TGGGGCTACTTGAGGAAGAACGG + Intergenic
1111965400 13:94856806-94856828 GGGGCCTACTTGGGGGTGAAGGG - Intergenic
1112134540 13:96562362-96562384 AGAGACTGCTTGAGGGAGAAGGG + Intronic
1112488641 13:99842330-99842352 TTTGACTGCTTTGGGGAGAAGGG + Intronic
1119114670 14:72008405-72008427 TGGGAGTCCTTGGGAGCCAAAGG + Intronic
1120663350 14:87276986-87277008 GGGGCCTACTTGAGGGAGAAGGG - Intergenic
1120973466 14:90229045-90229067 GAGGTCTCCTTGGGGGAGGATGG - Intergenic
1121086693 14:91151987-91152009 TAGGACTCCGTGGTGGGGAATGG - Intronic
1122115847 14:99526868-99526890 TGGGGCCCCTGGTGGGAGAATGG - Intronic
1122354911 14:101117039-101117061 TGGGACTTGTTGGGGGAGAGGGG + Intergenic
1122980564 14:105190747-105190769 GGGGCCTCCCTGGGTGAGAAGGG + Intergenic
1123059220 14:105586882-105586904 TGGGGCTGCTTGGGGGAGCATGG + Intergenic
1123083551 14:105707113-105707135 TGGGGCTGCTTGGGGGAGCATGG + Intergenic
1124865775 15:33489362-33489384 TGGGTCTACTTGAGGGCGAAAGG - Intronic
1125414860 15:39441976-39441998 TGGGGATCCCTGGGGGAGAAGGG + Intergenic
1125542386 15:40477204-40477226 TGGGACCACTTGAGGGTGAAAGG - Intergenic
1125681973 15:41536599-41536621 TGGCTCTCTTTGGAGGAGAAGGG + Exonic
1126204559 15:46030418-46030440 GGGGACTACTTGGGGGAGACGGG - Intergenic
1127201710 15:56660974-56660996 GGGGAGTGTTTGGGGGAGAAAGG + Intronic
1128064961 15:64758833-64758855 CCTGACTCCTTTGGGGAGAAGGG + Intronic
1128276321 15:66356708-66356730 GGGAACTCCTGGGGCGAGAAGGG + Exonic
1129205656 15:74035718-74035740 TGGGAAGCCATGGAGGAGAAGGG - Intronic
1129394420 15:75236267-75236289 TGGAAGGGCTTGGGGGAGAATGG - Intergenic
1129702353 15:77775152-77775174 AGGGAGTTCTTGGTGGAGAAAGG - Intronic
1130257067 15:82330735-82330757 TGGGACGCTTTGGGAGAGGAGGG + Intergenic
1130597883 15:85259255-85259277 TGGGACGCTTTGGGAGAGGAGGG - Intergenic
1130847417 15:87760136-87760158 TAGGACTCCTAGGGGGAGATCGG - Intergenic
1132601712 16:775787-775809 GGGGCCTCCTTGGTGGAGACAGG - Intronic
1133915703 16:10107651-10107673 TGGGATTCCCAGGGGGAGGACGG - Intronic
1134221016 16:12353886-12353908 TGTGCCTGCTTGGAGGAGAATGG + Intronic
1134297748 16:12961881-12961903 TGTGACTCCCTGGCAGAGAAAGG - Intronic
1135637447 16:24090645-24090667 AGGGACTGATTGGTGGAGAATGG + Intronic
1135740408 16:24970352-24970374 TGAGACTCCTTGGGAGAAAGTGG - Intronic
1136655278 16:31705794-31705816 TGGGACTCCAGGGAGGAGCAAGG + Intergenic
1137725636 16:50654884-50654906 GGGGTCTCCTTGGTGGAGGAGGG + Intergenic
1138270649 16:55693566-55693588 GGTGACTCCTTGGGGGCCAATGG - Intronic
1142780677 17:2179017-2179039 TAGGACTCCTTGTGAGAGGAAGG - Intronic
1142967486 17:3590544-3590566 TGGGACCCCTTGGGGGACCCTGG - Intronic
1144299730 17:13912226-13912248 TGGTTAGCCTTGGGGGAGAATGG - Intergenic
1144633721 17:16889756-16889778 TGGGTCTTCTTGGTGGAGATGGG + Intergenic
1145067410 17:19771138-19771160 TGGGGCTCCTGTGGGGAGATGGG + Intronic
1148131807 17:45266742-45266764 TGGGTCTCATTTGGGGAAAAGGG + Intronic
1150099095 17:62406230-62406252 TGGGAAGCCTTGGGGAAAAAAGG + Intronic
1151051089 17:70979256-70979278 TTGGCCTGCTTTGGGGAGAAAGG - Intergenic
1152987943 18:336430-336452 TGGGCCTCTTTGTGGGATAATGG - Intronic
1154068271 18:11129676-11129698 GAGGTCTCCTTGGGGAAGAATGG - Intronic
1154510177 18:15090999-15091021 AGGGACACCTTAAGGGAGAAGGG - Intergenic
1156192245 18:34733127-34733149 GAGGTCTCCTTGGGGAAGAATGG + Intronic
1156381715 18:36567819-36567841 TGGGATTACCTGGGGGAGAGGGG - Intronic
1157281038 18:46346480-46346502 TGGGACTTCTTGGGGGCCGAGGG + Intronic
1159180719 18:64900244-64900266 AGGGACTGGTTGAGGGAGAATGG - Intergenic
1159351117 18:67274042-67274064 TGGGCCTCTTTGTGGGTGAAGGG + Intergenic
1159663442 18:71127953-71127975 TGGGACTACTTAGGTGAAAATGG - Intergenic
1160218848 18:76957664-76957686 GGGGCCTCCTTGAGGGAGGAGGG - Intronic
1160875257 19:1293847-1293869 TGGGTCTCCAGGGGTGAGAAGGG - Intronic
1163505029 19:17700553-17700575 TGGGGCTCCCTAGGGGAGCAAGG + Intergenic
1163554923 19:17986484-17986506 TGAGAATCCTTCGGGGAGACGGG - Intronic
1163775315 19:19213843-19213865 TGGAACTCCGTGGAGGAGAAAGG - Intronic
1164337663 19:24346008-24346030 TGGGAGTACTTAGAGGAGAATGG + Intergenic
1164549084 19:29193245-29193267 TGGCACTTCCTGGGGGAGGAAGG - Intergenic
1164750844 19:30653752-30653774 CGGGACCCCTTGGCGGAGAAGGG - Intronic
1165053893 19:33161393-33161415 TGGGGCCCCTTGGGGGAACAGGG - Intronic
1165069859 19:33248984-33249006 GAGGACTGCTTAGGGGAGAAGGG - Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168617435 19:57850017-57850039 TCGGACTACTTGGGGAAGCACGG - Exonic
1168625726 19:57916411-57916433 TCGGACTACTTGGGGAAGCACGG + Exonic
926115433 2:10210155-10210177 TGGGAGTCCATGAGGGAGAAAGG - Intronic
926659705 2:15450993-15451015 TGGGACTGTTTGGGAGAAAAAGG + Intronic
926759142 2:16261960-16261982 TGGAAGTCCTTCGGGGAGAAGGG + Intergenic
927963275 2:27254203-27254225 TGGGTCCCTTTGAGGGAGAATGG - Intronic
928219999 2:29395600-29395622 TGGCTTGCCTTGGGGGAGAAAGG - Intronic
930207243 2:48600188-48600210 TGAGACTTCCTGGGGAAGAAAGG + Intronic
933299655 2:80527658-80527680 TGGGAGTCATTGGGAGAGAGAGG + Intronic
935978036 2:108598583-108598605 GGGGAATCCTTTTGGGAGAACGG + Intronic
936135654 2:109891177-109891199 GGGGAATCCTTTTGGGAGAACGG + Intergenic
936209043 2:110480308-110480330 GGGGAATCCTTTTGGGAGAACGG - Intergenic
938036154 2:128036683-128036705 TGGGTCCCCTTGGTGGAGAGGGG + Intergenic
938505399 2:131875437-131875459 AGGGACACCTTAAGGGAGAAGGG - Intergenic
938601907 2:132850971-132850993 TGAGACTCCTTGCAGGTGAATGG + Intronic
938899704 2:135789661-135789683 TGGGGATCCTTGGCAGAGAAGGG + Exonic
939778387 2:146413492-146413514 GGGGAGTGCTTGGAGGAGAAGGG - Intergenic
939880707 2:147627950-147627972 TGTGACTCCTTGGAGGAACATGG - Intergenic
941577439 2:167250905-167250927 AGCGACTCCTGGGTGGAGAAGGG - Exonic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
941741612 2:169041188-169041210 TGAGACTCTTTGGGGAATAAGGG + Intergenic
942090661 2:172487336-172487358 TGGGATTCCTTGGGTTGGAAGGG - Exonic
943443329 2:187951994-187952016 TGGGAGTCCATGGGGGGGAAGGG - Intergenic
944088914 2:195882873-195882895 TGGCACTCCTTGGGCCAGAACGG + Intronic
945426479 2:209710649-209710671 AGGAAATCCTTGGGGAAGAAAGG - Intronic
946342125 2:219076938-219076960 GGCTATTCCTTGGGGGAGAAGGG - Intronic
947001906 2:225466378-225466400 TGGGCTTACTTGGGGGATAAAGG + Intronic
947535011 2:230934737-230934759 TGGGACTCCTGGGGGGACTCTGG + Intronic
947712752 2:232325500-232325522 TGGGCCTCCCTGGGGCAGGAGGG - Intronic
948080127 2:235198915-235198937 TGAGACTGATTGGGGGATAAAGG + Intergenic
948620274 2:239230223-239230245 TGGGACCCCTTGGTCAAGAAGGG + Intronic
948960457 2:241331384-241331406 TGGGACAATTTGGGGGAGAAAGG - Intronic
1170315727 20:15039427-15039449 TGACACACCTTGGTGGAGAAAGG + Intronic
1171138553 20:22720537-22720559 TGGGACCCCTTGAGGGTGGAGGG - Intergenic
1172633287 20:36393164-36393186 TGGGAGTCATTAGGGCAGAAGGG + Intronic
1173134266 20:40425361-40425383 TTGGACTCCTTGGAGGACAGTGG + Intergenic
1173336261 20:42114666-42114688 TGACACAACTTGGGGGAGAAGGG - Intronic
1175237949 20:57526230-57526252 TGGGATACCTTGTGGGGGAATGG + Intergenic
1175457471 20:59126375-59126397 TGGGACCACTTGGAGGAGCAGGG - Intergenic
1175517414 20:59578062-59578084 TGGCCCTCCCTGGGGAAGAAGGG - Intronic
1176084412 20:63289545-63289567 AGGGACTCCCTGGGGCAGAGTGG - Intronic
1176787694 21:13278433-13278455 AGGGACACCTTAAGGGAGAAGGG + Intergenic
1177986859 21:27986888-27986910 AGGGACACCTTAAGGGAGAAGGG + Intergenic
1178406993 21:32332869-32332891 TGGGAGTCCTTGTGGGTGAATGG - Intronic
1179439108 21:41380774-41380796 TAGGGCCCCTCGGGGGAGAAGGG - Intronic
1180869463 22:19138156-19138178 TGGGACTCCCTGGGGGAGGTGGG - Intronic
1181429451 22:22869693-22869715 AGGGCCTCCTTAGGGAAGAATGG + Intronic
1183291395 22:37003894-37003916 AGGGACTCCCTGGGGCAGCAGGG - Intronic
1183453093 22:37906968-37906990 TGGGAAGCCTCGGGGGAGAGGGG - Intronic
1183954131 22:41369057-41369079 TGGGACACCTTGGGGGAGCCAGG - Intronic
1184413317 22:44338144-44338166 TTGGACCCCTTGGAGGAGGAAGG - Intergenic
949877306 3:8634660-8634682 TGGGTGTCCATGGAGGAGAAGGG + Intronic
950407636 3:12814630-12814652 TGGGACTCCAGAAGGGAGAAGGG - Intronic
950450715 3:13063592-13063614 TGGGAGGCATTGGGGGACAATGG + Intronic
952565925 3:34657788-34657810 GGGGCCTACTTGAGGGAGAAGGG - Intergenic
953023801 3:39133333-39133355 TGTGACTCCTCAGGGAAGAATGG - Intronic
953545370 3:43860454-43860476 TGGCATGCCTTCGGGGAGAAGGG - Intergenic
953897587 3:46813914-46813936 TAGGTCTCCTTGGGGAAGGATGG + Intergenic
954072190 3:48151073-48151095 GAGGAGTCCTTGGGGGAGGATGG + Intergenic
954396651 3:50296755-50296777 TGGGACCCCTTGGGGCAGCTTGG + Exonic
959078605 3:101777601-101777623 TATGAGTGCTTGGGGGAGAATGG + Intergenic
959324062 3:104913660-104913682 GGGGACTACATGGGGGAGAGAGG + Intergenic
959798470 3:110461295-110461317 TGGATCACCTTGGGAGAGAAAGG - Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962973346 3:140425165-140425187 TGGGAGTGCTTGGGGGAGGTGGG - Intronic
963160732 3:142149062-142149084 TGGGACTCGTGGGGGAACAAGGG + Intronic
964528132 3:157637308-157637330 TGACACGCCTTGGGGGAGAAAGG + Intronic
967385702 3:188908768-188908790 TGGGACTCCTATGGAGAAAAGGG + Intergenic
968481527 4:835137-835159 TGGGAATCGATGGGAGAGAAGGG - Intergenic
968600482 4:1506347-1506369 TGGGACTCCAGAGGGGAGCAGGG + Intergenic
968730655 4:2267854-2267876 TGGGACGAGGTGGGGGAGAAGGG - Intergenic
969485147 4:7468001-7468023 TGTGGCTCCATGGGGCAGAAAGG - Intronic
970039755 4:11782687-11782709 GGGGCCTACTTGAGGGAGAAAGG + Intergenic
970697717 4:18697280-18697302 TGGGTAGCCTTTGGGGAGAATGG + Intergenic
972217838 4:36916879-36916901 TGGCTAGCCTTGGGGGAGAATGG - Intergenic
972230772 4:37070324-37070346 TGGTACCCTTTGGGAGAGAAGGG - Intergenic
972696493 4:41451558-41451580 CAGCACTCCATGGGGGAGAAGGG - Intronic
973102752 4:46293351-46293373 AAGGTCTCCTTGGGGAAGAATGG - Intronic
975982815 4:80178695-80178717 GAGGTCTCCTTGGGGGAGGATGG + Intergenic
977465797 4:97381968-97381990 TAGGTCTCCTTGGGGAAGAATGG - Intronic
977930607 4:102745236-102745258 GGGGTCTCCTTGGGGAAGGATGG + Intronic
980744551 4:136998553-136998575 TGGGATCATTTGGGGGAGAAGGG + Intergenic
981834795 4:149042517-149042539 GAGGTCTCCTTGGGGAAGAATGG - Intergenic
984000917 4:174243355-174243377 TGGGATTCCTTTGGAGAGGAAGG + Intronic
984237067 4:177172432-177172454 TGGGACTTCTAGAGGGAGGAGGG - Intergenic
984674470 4:182531074-182531096 TGGGAGTGGTTGGAGGAGAATGG + Intronic
985820787 5:2158827-2158849 TGGGATTCCTTTCTGGAGAAAGG - Intergenic
986426907 5:7641679-7641701 TGGGACTACTAGAGGGAGGAGGG - Intronic
987039334 5:14046952-14046974 AGGGACGTCTTGGGGGAGGAGGG + Intergenic
987670198 5:20996960-20996982 TGGGACTACTTGGGGGGAATGGG + Intergenic
987779129 5:22410189-22410211 TGCCTATCCTTGGGGGAGAATGG - Intronic
988161010 5:27518298-27518320 GAGGCCTCCTTGGGGAAGAATGG + Intergenic
990232054 5:53723699-53723721 TGATATGCCTTGGGGGAGAAAGG - Intergenic
992416165 5:76553685-76553707 TGGGACTACTTGTGGCAGAAGGG - Intronic
992874311 5:81037840-81037862 TGGGTTTCTTTAGGGGAGAAAGG - Intronic
993412768 5:87593234-87593256 GAGGTCTCCTTGGGGAAGAATGG + Intergenic
993954576 5:94216331-94216353 TGGGACTCTTTAGGGGTGAAGGG + Intronic
994953553 5:106497847-106497869 AGGGACTCTGTGGGGGAGTAGGG - Intergenic
995875704 5:116786956-116786978 TGGCCAGCCTTGGGGGAGAATGG + Intergenic
997497906 5:134346018-134346040 TGATACACCTTGGGGGAGAAAGG - Intronic
998184032 5:139965223-139965245 TGGAACTACGTGGGGGAGATGGG + Intronic
998392083 5:141793647-141793669 TGGGGGATCTTGGGGGAGAAGGG - Intergenic
999083207 5:148863741-148863763 GGGGACTCCTTGTGGGGTAAAGG - Intergenic
999969266 5:156842773-156842795 TGGGATTCCTAAAGGGAGAATGG + Intergenic
1000101766 5:158023500-158023522 TGCGAGTCCTTGGGGGAAGATGG + Intergenic
1001407673 5:171487315-171487337 TTGGCCTCCTGGGGGAAGAAGGG + Intergenic
1001849031 5:174947092-174947114 GGGGCCTCCTTGAGGGTGAAGGG + Intergenic
1003379786 6:5613978-5614000 TGGGAGTCCTGGGGGGAAAAGGG + Intronic
1003508795 6:6762532-6762554 TGGCACTCGTTGGGGGAGGCGGG + Intergenic
1004325424 6:14670202-14670224 AGGGACAGCTTGGGGAAGAAAGG - Intergenic
1004824491 6:19404654-19404676 AGGGTCTCCTTGGGGAAGGATGG + Intergenic
1005589560 6:27310366-27310388 GGGGTCTGCTTGGAGGAGAAAGG + Exonic
1006101141 6:31687181-31687203 TGGGACTCATTATGGAAGAATGG - Exonic
1006452230 6:34111854-34111876 TGGCACTGCTTGGGGGAGTGTGG + Intronic
1007423146 6:41731698-41731720 TGGGGATCATTGGGTGAGAATGG - Intronic
1007667442 6:43523557-43523579 TGGGAGGGCTTGTGGGAGAAGGG + Exonic
1007831000 6:44638265-44638287 GGGGACTACTGTGGGGAGAAAGG + Intergenic
1008226492 6:48924658-48924680 TGGGATCCCTTGGCGAAGAAAGG - Intergenic
1009669353 6:66726683-66726705 TGAGACTCCAAGGGGGTGAAGGG + Intergenic
1010104069 6:72147530-72147552 TGGGACTCCTTGGGAAACAGAGG - Intronic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1013118054 6:107116915-107116937 GAGGACTGCTTGGGGGAGAATGG + Intergenic
1014746219 6:125203997-125204019 TGGGACTATTTGCAGGAGAAAGG - Intronic
1015184436 6:130398126-130398148 GGGGACTACTTGATGGAGAAGGG - Intronic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015894794 6:138006994-138007016 TGGGGCTCCTTGGGAAAGATGGG - Intergenic
1016453122 6:144203887-144203909 GGGGTCTACTTGAGGGAGAAGGG - Intergenic
1019451744 7:1102303-1102325 TGGGACTGCGCGGTGGAGAAGGG - Intronic
1020396517 7:7724116-7724138 GAGGTCTCCTTGGGGGAGGATGG - Intronic
1022379662 7:29847876-29847898 TGGTTAGCCTTGGGGGAGAATGG + Intronic
1023073152 7:36457767-36457789 TGGCTATCCCTGGGGGAGAATGG - Intergenic
1023992116 7:45134545-45134567 TGGGTCTCCTGGGCTGAGAAGGG + Intergenic
1024176952 7:46850343-46850365 AGGGACTTCTTGGTGGGGAAAGG + Intergenic
1025777064 7:64569328-64569350 TGGGTCTCGTGGGGGCAGAAGGG - Intergenic
1025973596 7:66351705-66351727 TGGGAATTCTTTGAGGAGAATGG + Intronic
1026161867 7:67876502-67876524 GGGGTCTCCTTGAGGGAGGAGGG - Intergenic
1029514632 7:101017739-101017761 AGGGAGTCCCAGGGGGAGAAGGG - Intronic
1029514640 7:101017758-101017780 AGGGAGTCCCAGGGGGAGAAGGG - Intronic
1029514918 7:101018332-101018354 AGGGAGTCCTAGGGGGAGAAGGG - Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1029955655 7:104636533-104636555 GGGGCCTACTTGAGGGAGAAGGG - Intronic
1031317419 7:120274115-120274137 TGAGACTCCTTTGGCGGGAAGGG + Exonic
1031575337 7:123409492-123409514 TGGGATTCCTTTGGTGTGAAGGG - Intergenic
1032371938 7:131364631-131364653 TGGGACTACTTGAGGGTGGAGGG - Intronic
1032655950 7:133929725-133929747 TGGGACTACTTGAGGGTGAAGGG - Intronic
1034170655 7:149060553-149060575 TAGGATTCTTTGGGGGAAAATGG - Intergenic
1034257591 7:149733138-149733160 TGGGACCTCTGGGGAGAGAAAGG + Intronic
1034389632 7:150775240-150775262 GGGGCCTACTTGAGGGAGAAGGG + Intergenic
1034544525 7:151781277-151781299 GGGGACTCCTGGTAGGAGAACGG + Exonic
1035456792 7:159014063-159014085 TGGGACTCCTTGGGAGACCGAGG + Intergenic
1035608605 8:946159-946181 TGTGACTCCCTGGGGGAGTCAGG - Intergenic
1038261059 8:25994775-25994797 TGGGACTACTTGAGGGTGGAGGG + Intronic
1039771775 8:40694735-40694757 AGGCTATCCTTGGGGGAGAATGG - Intronic
1039916741 8:41865712-41865734 TGGGACTGCTGGGGGGAGGAGGG - Intronic
1041914039 8:63121694-63121716 GGGGCCTCCTTGAGGGAGGAGGG - Intergenic
1042197620 8:66245985-66246007 GGGGCCTACTTGAGGGAGAAGGG + Intergenic
1047346552 8:124034317-124034339 TGGGACTCCTTAGAGGGGTAAGG + Intronic
1048043152 8:130750006-130750028 TGGTGCTGCTTGGGTGAGAAGGG + Intergenic
1048348387 8:133595588-133595610 GGGGACTCCTGGGGGAAGAGGGG + Intergenic
1048966296 8:139617205-139617227 TTGGAATGCTTGGGTGAGAATGG - Intronic
1048998549 8:139809674-139809696 GGGGACTCCTTAAGAGAGAATGG - Intronic
1049484941 8:142851023-142851045 TGTGACCCTTTGGAGGAGAAGGG - Intronic
1049777739 8:144414207-144414229 TGGGAGTCCATGGTGGGGAACGG + Intronic
1049785594 8:144449231-144449253 TGGGAGTCCCAGGGGAAGAAAGG + Intergenic
1050401601 9:5262007-5262029 TGGAACTCCTTGGGGAAAAGAGG - Intergenic
1050675581 9:8049119-8049141 GGGGACTCATTGGGGAAGAGGGG + Intergenic
1050871441 9:10575807-10575829 TGGAACCCCTAGGGAGAGAAAGG - Intronic
1052935092 9:34086282-34086304 TGGGATTGCTTGTGGCAGAAGGG - Intergenic
1054816963 9:69484685-69484707 TGAGAGCTCTTGGGGGAGAAGGG - Intronic
1055907018 9:81306678-81306700 GGGGACTCGTGGGGGAAGAATGG + Intergenic
1056808048 9:89743950-89743972 TGGGACCCCTGGGGGCAGCAGGG - Intergenic
1056813929 9:89786601-89786623 TGAGTTTCCTTGGGGGACAAAGG - Intergenic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1059061192 9:111037474-111037496 TAGGACTCCTTTGTGGTGAATGG - Intronic
1060219186 9:121755375-121755397 TGGGAGTCCTTGTGGGAGTTGGG + Intronic
1060513964 9:124254347-124254369 TGAAACTCTTTGGGGGTGAACGG + Intergenic
1060946814 9:127574571-127574593 AGGGACTCATGGGGAGAGAAAGG - Intronic
1062315479 9:135965089-135965111 GGGAACTCATTTGGGGAGAAGGG - Intergenic
1185556884 X:1028652-1028674 TAGGATTGCTTGGGGCAGAAAGG + Intergenic
1186978326 X:14932317-14932339 TGTGCCTCCCTGGGTGAGAAAGG + Intergenic
1187877396 X:23815633-23815655 TGGGACTCCCTCTGGGATAATGG + Intergenic
1189584159 X:42440690-42440712 GGGGACTCCTTGAGGGTGGAAGG + Intergenic
1190550497 X:51575017-51575039 TTGGTGTCCTTGGGGGAAAAAGG - Intergenic
1191134145 X:57045379-57045401 GAGGACTCCTTGGGGAAGAATGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192561637 X:72131561-72131583 TGGGGCTCCGTGGTGGGGAAAGG + Exonic
1193859878 X:86652100-86652122 GGGGCCTACTTGAGGGAGAAGGG - Intronic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1194765804 X:97844631-97844653 TCGGAAGCCTTGCGGGAGAACGG - Intergenic
1194849447 X:98853595-98853617 GAGGTCTCCTTGGGGGAGGAAGG + Intergenic
1194878875 X:99225344-99225366 TGGGCCTCCTTGAGGGTGGAGGG - Intergenic
1196314093 X:114202409-114202431 TGGCTAGCCTTGGGGGAGAATGG + Intergenic
1196575606 X:117314812-117314834 TGGGACTACTTGAGGGGGGAGGG - Intergenic
1197573233 X:128176136-128176158 TGGGCCTGCTTGGGGGTGGAAGG + Intergenic
1198103489 X:133441265-133441287 TGGGGCTTCTTGGGGGACATAGG + Intergenic
1198226449 X:134649931-134649953 TGGGTTGCCTTGGGGGAGAGAGG - Intronic
1199076808 X:143534686-143534708 TGGGACAACTTGGGAGAAAAGGG - Intergenic
1200299765 X:154961689-154961711 GGGGTCTCCTTGGCCGAGAAAGG - Intronic
1200684552 Y:6246841-6246863 TGTGACTCTTTGGGGAACAAAGG + Intronic
1200990081 Y:9338100-9338122 TGTGACTCTTTGGGGAACAAAGG + Intronic
1200992743 Y:9358415-9358437 TGTGACTCTTTGGGGAACAAAGG + Intronic
1200995396 Y:9378693-9378715 TGTGACTCTTTGGGGAACAAAGG + Intronic
1200998061 Y:9399039-9399061 TGTGACTCTTTGGGGAACAAAGG + Intronic
1201000571 Y:9467573-9467595 TGTGACTCTTTGGGGAACAAAGG + Intronic
1201003237 Y:9487903-9487925 TGTGACTCTTTGGGGAACAAAGG + Intronic
1201005894 Y:9508185-9508207 TGTGACTCTTTGGGGAACAAAGG + Intergenic
1201008551 Y:9528498-9528520 TGTGACTCTTTGGGGAACAAAGG + Intronic
1201011133 Y:9548667-9548689 TGTGACTCTTTGGGGAACAAAGG + Intergenic