ID: 906966415

View in Genome Browser
Species Human (GRCh38)
Location 1:50461408-50461430
Sequence TGACAGGTATACACTTTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 150}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906966415 Original CRISPR TGACAGGTATACACTTTGAA GGG (reversed) Intronic
906191305 1:43901118-43901140 TCACAGATAGACACTTTTAAGGG + Intronic
906966415 1:50461408-50461430 TGACAGGTATACACTTTGAAGGG - Intronic
911722443 1:101206060-101206082 TGACTGGTATAGTCTGTGAAAGG + Intergenic
911888071 1:103328854-103328876 TGACAGGGATACATTTTGCAGGG - Intergenic
917179146 1:172275163-172275185 TAAGTGATATACACTTTGAATGG - Intronic
919421299 1:197373408-197373430 TGATTTGTACACACTTTGAAGGG - Intronic
922481452 1:225942304-225942326 TGACAGGTAAACACTCTGTAAGG + Intergenic
923273779 1:232379585-232379607 TGAAAGGGAACCACTTTGAAGGG + Intergenic
924115697 1:240744049-240744071 TGCCAGGCATACACTGTAAATGG + Intergenic
924416393 1:243860774-243860796 AGAAAGGGATACACCTTGAAGGG + Intergenic
1063949376 10:11208049-11208071 TGAGAGGCATAGACTTTGAGGGG + Intronic
1068235273 10:54225919-54225941 TGACAAGTGTACAGTGTGAAGGG + Intronic
1070435587 10:76389313-76389335 TGACAGGAATAAAATTAGAAGGG + Intronic
1077571765 11:3345626-3345648 TCACAGGTTTCTACTTTGAAAGG - Intronic
1079199208 11:18360438-18360460 TGAAAGATATTCACATTGAAGGG + Intronic
1080144099 11:28958768-28958790 TGACAGGTAGAGCCTTTAAAAGG + Intergenic
1081076709 11:38683628-38683650 TGACATGTATTAACTCTGAAAGG + Intergenic
1087329675 11:96764683-96764705 TGACAAGTACACACTTAGATAGG - Intergenic
1094244352 12:28271010-28271032 TGACTAGGATACACTTTTAAGGG + Intronic
1096246189 12:49988598-49988620 TGACAGGGATACATTCTGAGAGG - Intronic
1103267606 12:119644123-119644145 TGACTGGTATCCATTTTGATAGG - Intergenic
1103541480 12:121669380-121669402 AGCCAGGTATACGCTGTGAATGG - Exonic
1105230451 13:18490100-18490122 TCAAAGGAATACACTCTGAAAGG + Intergenic
1106500225 13:30321237-30321259 AGACTGGTGTACACTTTAAATGG + Intergenic
1108318323 13:49260554-49260576 TGACTACTATACACTTTGGAAGG + Intronic
1110730395 13:78873810-78873832 TGAAAGATAATCACTTTGAAAGG - Intergenic
1114014708 14:18416915-18416937 TCAAAGGGATACACTCTGAAAGG + Intergenic
1117435909 14:55715131-55715153 TGAGAGGTATATACTTTGCTTGG + Intergenic
1119556802 14:75559613-75559635 TGACAGCTCTACACATAGAAAGG - Intergenic
1120311547 14:82834209-82834231 TTACAGGACAACACTTTGAAAGG - Intergenic
1121551156 14:94802141-94802163 TGAAAGGTATACACTTTATTAGG + Intergenic
1124913085 15:33942309-33942331 TGAAAGTGATACATTTTGAATGG - Intronic
1125427057 15:39558852-39558874 TGACAGGTATACACACTGCTAGG - Intergenic
1126379991 15:48036676-48036698 TGACAGGAAAACAAATTGAAAGG - Intergenic
1126926010 15:53587124-53587146 GGACAGTTATTCACTGTGAAAGG - Intronic
1127040090 15:54965536-54965558 TGGCAGGTATATACCTTCAAAGG + Intergenic
1130360029 15:83175414-83175436 TGGGAGGTGTACACTTTAAATGG - Intronic
1131417701 15:92275055-92275077 TGACAGGTATACACAAGCAAAGG - Intergenic
1131931731 15:97449957-97449979 TGACTGGGAAACACTTTGCAGGG - Intergenic
1134270082 16:12725405-12725427 TGACAAGTGTTTACTTTGAAGGG + Intronic
1136700496 16:32134918-32134940 TGAGAGATATATACTTTGATAGG + Intergenic
1141318240 16:82981844-82981866 TGAGAAGCATACACTGTGAATGG - Intronic
1143871942 17:9963401-9963423 TGAATTGTATACACTTTAAATGG + Intronic
1147640513 17:41995701-41995723 TGACAGGCATACATTTTGTTAGG - Intronic
1148869189 17:50645995-50646017 TGACATGTAAGCTCTTTGAAGGG - Intronic
1149414559 17:56445945-56445967 TGACAGGAATAAACTTAGCATGG - Intronic
1150566069 17:66341506-66341528 TGACATGTATACACAGTGCAAGG - Intronic
1154522952 18:15249770-15249792 TCAAAGGGATACACTCTGAAAGG - Intergenic
1156616802 18:38796190-38796212 AGACAGGTATACCCTATCAAGGG + Intergenic
1159175885 18:64833283-64833305 TGACACGTTAAGACTTTGAAAGG - Intergenic
925224428 2:2170814-2170836 TGACAGCCACACACTGTGAAGGG - Intronic
928039697 2:27862331-27862353 TGACAGGTATTCACAAAGAAAGG + Intronic
929156945 2:38796920-38796942 TGAAAGGTATTCACTTTTCAAGG - Intergenic
929626309 2:43411751-43411773 TTACAAGTATACAGTTTCAATGG + Intronic
932394089 2:71427409-71427431 TAACAGGTAGATACTTGGAAGGG + Exonic
932795224 2:74689029-74689051 AGACAGCAACACACTTTGAAAGG + Intergenic
933111345 2:78405360-78405382 GTACAGGTATACATTTTTAATGG + Intergenic
934941083 2:98502527-98502549 TGACAGGGAGACACTTTGTGAGG + Intronic
935099598 2:99980497-99980519 AGACAGATATACCCTATGAAAGG + Intronic
935291532 2:101614712-101614734 TGACAGGAATACATTTTGAGAGG + Intergenic
938522240 2:132082616-132082638 TCAAAGGGATACACTCTGAAAGG - Intergenic
939310074 2:140464468-140464490 TAACAGGAATACTCTTTGGATGG - Intronic
939903156 2:147875893-147875915 TGAGAAGTATAAACTTTGAGAGG - Intronic
941264014 2:163336642-163336664 TGATAGGTATATATTTTTAAAGG - Intergenic
944149671 2:196544445-196544467 TCACAGGTGTACGCTGTGAAAGG - Intronic
945983004 2:216329424-216329446 TGACAGGTTTAAACTTTCTAAGG + Intronic
948265836 2:236634798-236634820 TGACAGGTACACACCTGGCAAGG - Intergenic
1169514940 20:6305691-6305713 TGAGTTGTTTACACTTTGAAAGG - Intergenic
1170075585 20:12415364-12415386 TGACAGATATCCCCTCTGAAGGG - Intergenic
1170099881 20:12687310-12687332 TCAAAGGTATAAACTTTTAATGG - Intergenic
1176774440 21:13118445-13118467 TCAAAGGGATACACTCTGAAAGG + Intergenic
1177073410 21:16541431-16541453 TGACTGGTATTCACTTTCTAAGG - Intergenic
1179260228 21:39751302-39751324 TGACAGGTAAACCCTTTGGAGGG - Intronic
1180439208 22:15347722-15347744 TCAAAGGGATACACTCTGAAAGG + Intergenic
1180522062 22:16218159-16218181 TCAAAGGGATACACTCTGAAAGG + Intergenic
950737106 3:15018340-15018362 TGTCAGGTGTACAGTTTGCATGG - Intronic
951892845 3:27583183-27583205 TGACAACTTTATACTTTGAAAGG - Intergenic
953250279 3:41239471-41239493 AAACAGGTATATACTTTGAAAGG + Exonic
955766901 3:62354468-62354490 TGTCTAGTATACTCTTTGAAAGG + Intergenic
956338184 3:68188910-68188932 GGCCAGGTGTGCACTTTGAATGG + Intronic
957807832 3:85173622-85173644 TGACAGGAAGACATTTTGAAAGG + Intronic
959468212 3:106716185-106716207 TGACAGTAATACACTGTGTATGG + Intergenic
960593132 3:119384651-119384673 TGACATGAATCCACTTAGAAGGG + Intronic
962339236 3:134568130-134568152 TGACAGGCATCCACTGTGGATGG + Intronic
962835356 3:139184686-139184708 TGACAGGTAAGCACTTTGGGGGG + Intronic
965460999 3:168963244-168963266 TGAAAGGTATACAGATTGGAAGG - Intergenic
966097258 3:176219319-176219341 TGACAGGGATAGACTGTAAAAGG + Intergenic
966922803 3:184625087-184625109 TGAGAGGTATAGAAATTGAATGG + Intronic
966985146 3:185173115-185173137 TGACAGGTATATAATTTTAGGGG + Intergenic
971518274 4:27516135-27516157 TGACAGGTATATACTTTCTGTGG + Intergenic
973872495 4:55180310-55180332 TGGGAGGTATACAAGTTGAATGG + Intergenic
974449194 4:62029402-62029424 TGACAGGTGTCAAATTTGAAAGG - Intronic
975124880 4:70770648-70770670 TGACAGGAATAAAGTTTGAGTGG - Intronic
978554934 4:109969900-109969922 TGACAGGTGTACACTCCCAAAGG + Intronic
980382636 4:132044323-132044345 AGAAAATTATACACTTTGAATGG - Intergenic
980860016 4:138487680-138487702 CCATAGGTATGCACTTTGAAAGG - Intergenic
982141330 4:152322478-152322500 TGACAGCTAGACACCTAGAAAGG - Exonic
982783166 4:159512141-159512163 TCACAGGTCTACAAATTGAAAGG - Intergenic
985246903 4:187988203-187988225 TAAAAGGTATAAACTTGGAATGG + Intergenic
986953388 5:13119676-13119698 TAACAAGTATACACTTACAATGG - Intergenic
987693902 5:21303355-21303377 TTACATGTAAATACTTTGAATGG - Intergenic
989997856 5:50856962-50856984 TCACAGGAAGACACTTTGAATGG - Intergenic
991746351 5:69746176-69746198 TTACATGTAAATACTTTGAATGG + Intergenic
991751354 5:69809065-69809087 TTACATGTAAATACTTTGAATGG - Intergenic
991797953 5:70326129-70326151 TTACATGTAAATACTTTGAATGG + Intergenic
991825729 5:70621490-70621512 TTACATGTAAATACTTTGAATGG + Intergenic
991830642 5:70683959-70683981 TTACATGTAAATACTTTGAATGG - Intergenic
991890294 5:71325447-71325469 TTACATGTAAATACTTTGAATGG + Intergenic
992037262 5:72792397-72792419 TGAAAGCTATAAACTGTGAAAGG - Intergenic
993293087 5:86100812-86100834 TGACAAGTATACACTGCAAAGGG + Intergenic
993372732 5:87112646-87112668 GGACAGGTACACAATTTAAATGG - Intergenic
993957041 5:94246922-94246944 TGAAAGATATACAGTTTGGAAGG + Intronic
994649235 5:102505553-102505575 TAACAGAAATACACTTTTAAAGG - Intergenic
997416735 5:133734699-133734721 AGACATGTATACAAATTGAAAGG - Intergenic
998680836 5:144465433-144465455 TGTCAGGTATACAGTTGGGAAGG - Intronic
998721382 5:144954693-144954715 AGACAGGTAAACACATTGAGTGG - Intergenic
1000569302 5:162892270-162892292 TAACAGTAATACACTTTGCATGG - Intergenic
1000823795 5:166018428-166018450 TGACAGGAATACACTATATATGG + Intergenic
1005055180 6:21722508-21722530 TGGCACGCAGACACTTTGAAGGG + Intergenic
1005213631 6:23498898-23498920 TGACTGGTATACTCTTAAAAGGG - Intergenic
1005557007 6:26996564-26996586 TTACATGTAAATACTTTGAATGG + Intergenic
1009241367 6:61189782-61189804 AGAAAGACATACACTTTGAAAGG + Intergenic
1012090325 6:94885576-94885598 TGAGAAGTATACAGATTGAAAGG - Intergenic
1013805646 6:113993148-113993170 TGACATCTCTACACTGTGAAAGG - Intronic
1015056000 6:128904089-128904111 GGACATATATACACTTTGATAGG + Intronic
1016871230 6:148818779-148818801 TCACAAGTATACAATTTGAGTGG - Intronic
1018489060 6:164272945-164272967 TGACTGGTGTGCACTTTGGATGG + Intergenic
1020950619 7:14671308-14671330 TGAAAGGTAGACATTTTGGAAGG + Intronic
1023783018 7:43675745-43675767 TGTCAAGATTACACTTTGAAGGG + Intronic
1024788551 7:52935795-52935817 CAACAAGTATACAGTTTGAAGGG + Intergenic
1026526674 7:71159611-71159633 TGACAGGTATACAATTCAACTGG + Intronic
1028771235 7:94624432-94624454 TAAAAGGTATATATTTTGAAAGG + Intronic
1033488465 7:141815771-141815793 TGACAGGGAAACACATTTAATGG - Intergenic
1038189893 8:25310527-25310549 TGCCAGGTAAGCACTTTGCATGG + Exonic
1039774100 8:40718905-40718927 TGACATATATACACTTTCCAAGG + Intronic
1041766486 8:61423518-61423540 TGACAAGGTTTCACTTTGAAAGG - Intronic
1045422010 8:102025775-102025797 CTACAGGTATACATTTTGGAGGG + Intronic
1046163630 8:110399258-110399280 TGACAGGTAACCACATTTAATGG - Intergenic
1046295414 8:112213548-112213570 TAACAGATATACACTCTGAGGGG + Intergenic
1049482017 8:142829798-142829820 TAACAGTTATTCATTTTGAAGGG - Intergenic
1050131192 9:2414516-2414538 TGGCAGGGACACACATTGAAGGG - Intergenic
1050872043 9:10583806-10583828 TGATAGCTATGCTCTTTGAAAGG + Intronic
1051168733 9:14295765-14295787 TGACAGTTTTACACTTTTATTGG + Intronic
1051386457 9:16514309-16514331 TGGCAGCTATCCTCTTTGAATGG - Intronic
1051874089 9:21772316-21772338 TGCTAGGTATAGAGTTTGAAAGG + Intergenic
1052057026 9:23917890-23917912 TGACTGGTATATACCTTGAACGG + Intergenic
1055079171 9:72250820-72250842 TCAACGGAATACACTTTGAAAGG + Exonic
1058726550 9:107810219-107810241 TGACAGTTCTACACTATGGAAGG + Intergenic
1059145213 9:111893872-111893894 TGACATGTATACACTATTATAGG + Intergenic
1187119011 X:16385081-16385103 TGACAGGTCAACACTATCAAGGG - Intergenic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1188083358 X:25873329-25873351 TGACAGGAATACATTCTGAGAGG - Intergenic
1192972419 X:76247487-76247509 TGAAAGGTATCCAAATTGAAAGG - Intergenic
1193466140 X:81849749-81849771 TTACAGGTATTCTTTTTGAAAGG - Intergenic
1193547474 X:82847335-82847357 GGACTAGTAGACACTTTGAATGG + Intergenic
1197189612 X:123631342-123631364 TGTTATGTATACACTCTGAAGGG - Intronic
1199462147 X:148096499-148096521 TGAGAGGTATAGAGTGTGAAGGG + Intergenic
1201531842 Y:14998877-14998899 TGAAAGGCATACACATTGGAAGG - Intergenic
1202048845 Y:20760397-20760419 TGTCAGGCAGGCACTTTGAAGGG + Intronic