ID: 906967421

View in Genome Browser
Species Human (GRCh38)
Location 1:50472103-50472125
Sequence CCGTAGGTCTGGAGGGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906967415_906967421 -8 Left 906967415 1:50472088-50472110 CCTATGTTTGGGCTACCGTAGGT 0: 1
1: 0
2: 0
3: 4
4: 56
Right 906967421 1:50472103-50472125 CCGTAGGTCTGGAGGGGAGCTGG 0: 1
1: 0
2: 2
3: 10
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906967421 Original CRISPR CCGTAGGTCTGGAGGGGAGC TGG Intronic
900157859 1:1210769-1210791 GCGTAGGTGTGGAGGGGAAGAGG + Intergenic
901674162 1:10873221-10873243 CACTGGGTCTGGAGGGGATCAGG + Intergenic
901877211 1:12173735-12173757 CCCTAGGCCTGGAAGGGGGCAGG - Intronic
902115702 1:14119216-14119238 CCATGGGTCTGTAGGGGAGCAGG + Intergenic
902646789 1:17805117-17805139 CCGTGTGGCTGGAAGGGAGCTGG - Intronic
903906932 1:26694378-26694400 CCTTGGGTCTGGTGAGGAGCTGG + Intergenic
904396948 1:30228372-30228394 CCCTAGGGGTGGAGTGGAGCAGG - Intergenic
905225433 1:36475657-36475679 CCCCAGGTCTGGAGGAGTGCGGG - Exonic
906967421 1:50472103-50472125 CCGTAGGTCTGGAGGGGAGCTGG + Intronic
907046601 1:51303505-51303527 CCCAAGGTCTGGTTGGGAGCAGG + Intronic
912812682 1:112805755-112805777 CTGGAGGTCTGGTGGGGAGGTGG + Intergenic
919729079 1:200901494-200901516 CTGTGGGCCTGGAGGGCAGCGGG - Intronic
919765497 1:201124678-201124700 CTGCAGGGCTGGAGGGGAGACGG + Intronic
923338947 1:232991774-232991796 CCTGAGGGCTGGAGGGGAGTGGG - Intronic
1068792825 10:61046002-61046024 ACGCAGCTCTTGAGGGGAGCAGG + Intergenic
1070677355 10:78421156-78421178 CCCCAGGTTTGGCGGGGAGCAGG + Intergenic
1074011621 10:109487668-109487690 GAGTAGGTCTGGGGTGGAGCTGG + Intergenic
1075399659 10:122151769-122151791 CCGTGGGGATGGAGGGGACCTGG + Intronic
1076063349 10:127430055-127430077 CTGTAGGTGGGGAGGGGAGAGGG - Intronic
1076454348 10:130579052-130579074 CCCTATGGCTGGAGGGAAGCAGG - Intergenic
1077295646 11:1825183-1825205 CCGTAGGGCAGGGAGGGAGCAGG + Intergenic
1077299501 11:1840474-1840496 AGGTGGGTCTGCAGGGGAGCTGG + Intronic
1077537190 11:3130026-3130048 GTGTAGGGCTGGTGGGGAGCAGG - Intronic
1078182911 11:9027538-9027560 CAGAAGATGTGGAGGGGAGCTGG - Exonic
1078451864 11:11446520-11446542 TCCTGGGTCTGGAGAGGAGCTGG - Intronic
1081860909 11:46332980-46333002 CCGGACGGCTGGAGCGGAGCCGG - Intronic
1083590450 11:63890585-63890607 CACCAGGTCTGGAGGAGAGCGGG + Intronic
1084320901 11:68372894-68372916 GCGAAGGTCAGGAGGGGGGCAGG + Intronic
1084610862 11:70202281-70202303 CCGTGGGTCTGGAGGTGAGGAGG - Intergenic
1084889080 11:72227956-72227978 GTGTAGGTCTGGTGGGGAGACGG + Intronic
1085345782 11:75767518-75767540 CTGTAGGTCAGGAGGGCAGTGGG - Intronic
1087278689 11:96185971-96185993 CAGTAGGTCTGGGGAGGGGCTGG - Intronic
1087285761 11:96263724-96263746 CAGCAGGTATGGAGGGGGGCTGG + Intronic
1088811564 11:113396009-113396031 AGGTAGGGCTGGAGGGGAGCTGG - Intronic
1089072514 11:115711351-115711373 CTGTATGACTGGAGGAGAGCAGG - Intergenic
1089301229 11:117499901-117499923 CCGAGGGTCTGGATGGGAGTCGG - Intronic
1089732073 11:120525408-120525430 CATTAGGTCAGGTGGGGAGCAGG - Intronic
1091920442 12:4299972-4299994 CCGCACGTCTGTAGGGGTGCTGG - Exonic
1095605324 12:44060627-44060649 AAGTATGTCTGGAGAGGAGCAGG + Intronic
1095705158 12:45228977-45228999 ACTTGGGTCTGGAGGGGAGAAGG + Intronic
1097237799 12:57551558-57551580 CTGTAGGGCTTGAGGGGTGCTGG + Intronic
1098740531 12:74168479-74168501 GGGTAGGGCAGGAGGGGAGCAGG + Intergenic
1102008375 12:109603093-109603115 CCCTAGGTCTGGAGGGAGGCAGG - Intergenic
1102011819 12:109623824-109623846 GGGTAGGTCTGGTGGGGAGCTGG - Intergenic
1103243965 12:119439348-119439370 CCCTAGACCTGGAGGGGAGAAGG + Intronic
1103328490 12:120137569-120137591 CTGTGGTTCTGGAGGAGAGCTGG - Exonic
1104076106 12:125391553-125391575 CTGCAGGTCTGCAGGGGAGTAGG - Intronic
1104676176 12:130713990-130714012 CAGCAGGTCTGGGGAGGAGCCGG - Intronic
1104806119 12:131590543-131590565 CTGTAGGTCTGGAGGGGGGCTGG + Intergenic
1107728545 13:43324782-43324804 GCGTGGGTGTGGTGGGGAGCAGG - Intronic
1110137323 13:72084224-72084246 CCATAGGTATGAAGAGGAGCTGG + Intergenic
1115927531 14:38452289-38452311 CCGGAGGTATGAAGAGGAGCTGG + Intergenic
1119951999 14:78754706-78754728 CAGTAGGTCTAGAGTGGAGTGGG - Intronic
1121002893 14:90464833-90464855 CAGTAGGTCTGGGGTGGGGCTGG + Intergenic
1121173430 14:91872929-91872951 CCCAAGGTCTGGAAGGGAGAAGG + Intronic
1121439039 14:93937235-93937257 CCGCAGGTCTGGGGCGGGGCCGG - Intronic
1121551925 14:94809433-94809455 CCCTAGGGCTGGGGAGGAGCTGG - Intergenic
1126368318 15:47918884-47918906 CCGAAGTTGTGGAGGGGTGCGGG + Intergenic
1126674168 15:51144912-51144934 ACAAAGGTCTGGAGGGGAGAAGG + Intergenic
1126692060 15:51295372-51295394 GCCTAGGAATGGAGGGGAGCGGG - Intronic
1127927017 15:63556571-63556593 CCCTAGGTGTTGAGGGCAGCTGG + Intronic
1131180061 15:90233557-90233579 CCTGAGGTCTGCAGAGGAGCGGG - Intronic
1135619888 16:23946743-23946765 CAGTAGGTCTGGGGAGGGGCCGG + Intronic
1137505510 16:49050866-49050888 CAGTAGGTCTGGAGGGATGTGGG - Intergenic
1138970144 16:62133848-62133870 TCTCAGGTCTGGAGGGCAGCAGG + Intergenic
1140951142 16:79818600-79818622 GAGAAGGTCTGGAGTGGAGCTGG - Intergenic
1141102581 16:81208918-81208940 CAGTAGGTATGGAGTGCAGCTGG + Intergenic
1142170091 16:88617279-88617301 CCGCAGGTCCAGGGGGGAGCTGG - Intronic
1142502335 17:340060-340082 CAGTGGGTCTGGTGGGGAGCAGG - Intronic
1143473457 17:7190477-7190499 CCTGGGGTCTGGGGGGGAGCTGG - Exonic
1143562650 17:7704945-7704967 TCGGAGGGCAGGAGGGGAGCCGG + Intergenic
1143628476 17:8123957-8123979 CCGTCGGTCTGGAGAGAGGCTGG - Intronic
1143887198 17:10073573-10073595 TAGGAGGTCTTGAGGGGAGCGGG - Intronic
1147164495 17:38586209-38586231 CCCTTGGTGGGGAGGGGAGCTGG - Intronic
1147769405 17:42857153-42857175 CCATAGGGCTGGAGAGGAGACGG - Exonic
1148564624 17:48625699-48625721 CCGAAGGCCAGGAGGGGGGCGGG - Intronic
1149988707 17:61368232-61368254 CCCTGGGTATGGAGAGGAGCGGG + Intronic
1150790186 17:68196711-68196733 CCATTGGGCTGGAGGGCAGCAGG + Intergenic
1151188869 17:72383172-72383194 CCAGAGGTCAGGAGGGTAGCGGG - Intergenic
1151464051 17:74273127-74273149 CAGTAGCTCTGGACGGGGGCTGG + Intergenic
1151701125 17:75743121-75743143 CCCCAGGGCTGGAGGAGAGCAGG - Intronic
1157337525 18:46752551-46752573 CCCTTGGTCAGGAGGGGAGAAGG - Intronic
1158557581 18:58487987-58488009 CAGTAGGTCTGGAGTGGGGGTGG + Intronic
1159303984 18:66616102-66616124 GCCTAGGTGTGGAGTGGAGCGGG - Intergenic
1160070847 18:75626490-75626512 CCTTAGCTATGGAGGGCAGCTGG - Intergenic
1160534527 18:79585098-79585120 CTGCAGGTCTGCAGGGGGGCTGG - Intergenic
1162445247 19:10718633-10718655 CCGTAGGACAGGAGGTGCGCTGG + Intronic
1163005888 19:14396494-14396516 CCGTGAGGCTGGACGGGAGCTGG + Intronic
1163252824 19:16136417-16136439 CCGTGGGTCTTGAGTGGTGCTGG - Intronic
1163284093 19:16335514-16335536 GCCTAGGTGGGGAGGGGAGCTGG - Intergenic
1167117219 19:47495347-47495369 CCGTCAGGCTGGTGGGGAGCTGG + Intronic
1167435357 19:49475676-49475698 AGATAGGTCTGCAGGGGAGCGGG - Exonic
1168109906 19:54186530-54186552 CAGGATGTGTGGAGGGGAGCAGG - Intronic
1168147861 19:54429779-54429801 CCCTGGGTGGGGAGGGGAGCTGG + Intronic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
930108490 2:47658335-47658357 CTCCAGGTCTGGAGGGGAGGCGG - Intergenic
931414520 2:62068233-62068255 CTGTATGTGTTGAGGGGAGCAGG + Intronic
932495981 2:72146024-72146046 CCCTAGATCTGGAGGTGAGGAGG - Intronic
932598947 2:73111353-73111375 CCTTAGGTCAGGAGAGGTGCCGG - Intronic
932606550 2:73169503-73169525 CAGGAGGTCTGGTGGGGAGAGGG + Intergenic
933845075 2:86319215-86319237 CAGTAGGTCTGGAGGGGGCGAGG + Intronic
933925876 2:87090932-87090954 CAGGAGGTCTGGTGGGGAGAGGG - Intergenic
934733105 2:96671888-96671910 CCTTAGGTCAGGAGAGAAGCTGG + Intergenic
934778091 2:96951466-96951488 CTGTTGGGCTGGCGGGGAGCTGG + Exonic
938072923 2:128317887-128317909 CGGCAGGTCGGGAGGGGTGCCGG + Intronic
938540647 2:132281228-132281250 CCGTGGGGCTGCAGGGGAGGGGG + Intergenic
938598281 2:132811556-132811578 CCTTAGGTTTGCATGGGAGCTGG - Intronic
939118015 2:138083495-138083517 CCTTAGGTCAGGAGGGGAAGTGG - Intergenic
941155583 2:161973750-161973772 CCATAGGTCTGGAGTAGAGTGGG - Intronic
942748738 2:179264695-179264717 CCGTGCGTCAGGCGGGGAGCGGG + Exonic
943266534 2:185739033-185739055 CCGCAGGCCTGCTGGGGAGCGGG + Intronic
943755591 2:191553762-191553784 CAATAGGTCTGGGGTGGAGCTGG - Intergenic
946398201 2:219453967-219453989 CCGTAGGCCTGGTGGGGAGCAGG + Intronic
946463323 2:219889522-219889544 CCCTAGGTATGGATGGGATCAGG + Intergenic
946767144 2:223051309-223051331 TCGTAGGTCAGGGGAGGAGCAGG - Intergenic
946944676 2:224808554-224808576 GCGCAGGTGTGGAAGGGAGCAGG + Intronic
947722576 2:232378786-232378808 CAGCATGTCTGGAGGGCAGCAGG - Exonic
947726252 2:232402692-232402714 CCCTAGGTGTGGTGGGGAGTGGG + Intergenic
948693436 2:239720970-239720992 CAGGAGGTTTGGAGGGGAACTGG + Intergenic
948798530 2:240419528-240419550 TCGTGGGTGTGGAGAGGAGCTGG - Intergenic
1170522550 20:17202582-17202604 CCTCAGTTCTGGAGGGGATCAGG - Intergenic
1172601989 20:36190417-36190439 CCATGTGTATGGAGGGGAGCAGG + Intronic
1173044605 20:39497579-39497601 GCGTAGCTCTGGAGGGGAAATGG + Intergenic
1175166699 20:57049095-57049117 CTGGAGGTCTGGAGAGGGGCAGG + Intergenic
1175182122 20:57156174-57156196 ACGTAGGACTGGAGAGTAGCTGG + Intergenic
1175599772 20:60263755-60263777 CTGTAGGTCTGGAAGAGACCTGG + Intergenic
1178744775 21:35238261-35238283 CAGCAGGGGTGGAGGGGAGCTGG + Intronic
1179456849 21:41506450-41506472 CAGTAGTTCTGTAGCGGAGCAGG + Intronic
1179823701 21:43952085-43952107 CCGTAGTTCTGGAGAGGTACGGG - Intronic
1180179312 21:46111009-46111031 GCCTAGCTCTGCAGGGGAGCCGG + Intronic
1183258340 22:36777583-36777605 AGGTTGGCCTGGAGGGGAGCCGG - Intergenic
951346154 3:21548572-21548594 CCGTAAGTATGGAAGGGAACAGG - Intronic
952594540 3:35000176-35000198 CAGTAGGTCTTGTAGGGAGCTGG + Intergenic
958661355 3:97071739-97071761 CCATAGGTTTTGAGGGGAACAGG + Intronic
959933142 3:112003870-112003892 CCGTAAGTCTGGAGGAGCCCAGG + Intronic
962212055 3:133487346-133487368 GCCTAGGTCTGCAGGGCAGCTGG + Intergenic
962898822 3:139739021-139739043 CAGTAGGTCTGGAATGGGGCTGG + Intergenic
964219203 3:154324585-154324607 CCGGTGGTCTGGAGGGTGGCAGG + Intergenic
964409353 3:156382138-156382160 CAGTAGATCTGGATGGGACCTGG - Intronic
966252368 3:177880630-177880652 CAGTAGGTCTGGGTGGGACCTGG + Intergenic
968000293 3:195200989-195201011 CCGTAGGTCTGGGGTTGGGCTGG - Intronic
968500726 4:948602-948624 CTGCAGGCCTGGAGGTGAGCGGG + Intronic
970502951 4:16696877-16696899 TAGTAGGTCTGGAGTGGTGCCGG + Intronic
978413107 4:108446761-108446783 TGGTAGGTGGGGAGGGGAGCAGG - Intergenic
980084846 4:128380448-128380470 CAGTAGGTCTGGGGCGGGGCTGG + Intergenic
980129380 4:128804038-128804060 CAGTAGGTCTGGGGTGGGGCTGG + Intergenic
983511510 4:168613937-168613959 TATTAGGTCTGGAGGGCAGCAGG - Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985924392 5:3004585-3004607 CCCCAGGTCTGGATGGGACCAGG - Intergenic
989523858 5:42430114-42430136 TTGTAGGTCTGGACAGGAGCTGG + Intronic
992519857 5:77539436-77539458 CAGTAGGTCTGGGGTGGAGTGGG + Intronic
996483383 5:124001225-124001247 CAGAGGGTCGGGAGGGGAGCTGG + Intergenic
998040604 5:138948798-138948820 GCCTAGGTCAGGAGGGCAGCGGG + Intronic
999204453 5:149837954-149837976 CTGTAGGTCTGGGGTGGGGCAGG + Intronic
1000004068 5:157166759-157166781 CTGTAGTTCTGATGGGGAGCAGG - Intronic
1004085997 6:12449813-12449835 TCGTAGTTCTGGAGGGTAGGAGG - Intergenic
1005161695 6:22871527-22871549 CAGAAAGGCTGGAGGGGAGCTGG + Intergenic
1006806228 6:36791494-36791516 CTGTAGGACTGTGGGGGAGCAGG - Intronic
1007351127 6:41274267-41274289 CAGTAGGTCTGCAGGGGCCCTGG + Intronic
1015856580 6:137631454-137631476 CCTTAGGGCTGGAAGGAAGCTGG + Intergenic
1018995421 6:168706350-168706372 CCTTCGGTCTGGAGGAGCGCAGG + Intergenic
1019979900 7:4613790-4613812 CGGGAGGTCTGGAAGGGAGTAGG - Intergenic
1020559339 7:9710424-9710446 CAGGAGATCTGGAGTGGAGCCGG - Intergenic
1024965219 7:55018527-55018549 CCGTAGTGCTGCAGGGGAGGTGG + Intergenic
1026045744 7:66904339-66904361 CCGTCGGGCTGGGCGGGAGCCGG - Intergenic
1026292281 7:69018506-69018528 TCTGAGGTCTGGAGGGCAGCAGG + Intergenic
1028018650 7:85744517-85744539 CCTTAGGTGTGGAGGGAAGTGGG + Intergenic
1029456452 7:100674641-100674663 CCGCAGGTCTGGCGGGGCTCAGG - Intronic
1030069926 7:105689629-105689651 CCGTATGTCTGGTTGGGACCGGG - Intronic
1030303918 7:108001498-108001520 CCTTAGGTCTGGACGGGAGGAGG + Intronic
1030974511 7:116105065-116105087 CCATAGGACTGGAGGGCTGCAGG - Intronic
1031088227 7:117323895-117323917 CCGCAGCTCCGGAGAGGAGCTGG - Intergenic
1034439035 7:151077229-151077251 CAGGAAGTCTGGAGGGGAGCAGG + Exonic
1034963663 7:155378097-155378119 CCGCGGGTCTGGACGCGAGCTGG - Intergenic
1034989999 7:155542288-155542310 CCGTAGGTCCGGGGAGCAGCTGG - Intergenic
1037522284 8:19691858-19691880 CAGTAGGTCTGGGTGGGGGCTGG - Intronic
1039805405 8:40993410-40993432 CCTGAGGTCTGGATGAGAGCAGG + Intergenic
1043328780 8:79086966-79086988 CCGGAAGTGTGGAGGGGCGCTGG + Intergenic
1046021844 8:108674832-108674854 ACGCAGCTCTGGAGGGGAGGTGG + Intronic
1047348279 8:124049431-124049453 CCGTAGGTCTGGGGAGCAGTGGG - Intronic
1047480776 8:125280929-125280951 CTGTAGGTTTGTAGGGCAGCAGG - Intronic
1049372545 8:142274690-142274712 CCGTCTGTCTGGAGGGGCCCAGG - Intronic
1049662188 8:143824454-143824476 CCTTAGCTCGGGAGGAGAGCAGG - Intronic
1049703349 8:144024764-144024786 GGGTAGGTCTTGAGGGGAGAGGG - Intronic
1049832588 8:144711569-144711591 GCATAGGTCTTGAGGGAAGCTGG + Intergenic
1055111624 9:72565881-72565903 CCATGTGTCTTGAGGGGAGCTGG - Intronic
1055791371 9:79926495-79926517 CCGGAGGTCTGGAGGTGGGGTGG - Intergenic
1059521001 9:114942053-114942075 TAGTAGGTCTGTAGGGGAGGAGG + Intergenic
1060376231 9:123117234-123117256 CTGTAATCCTGGAGGGGAGCAGG - Intronic
1061986910 9:134135420-134135442 CCGCGGGGCTGGCGGGGAGCAGG + Intronic
1062267275 9:135692951-135692973 CCTGAGATCTGGAGGGGAGCTGG - Intergenic
1062400919 9:136372297-136372319 CGGCTGGTCTGGTGGGGAGCGGG - Intronic
1186466255 X:9786383-9786405 CCGGAGGGCTGGCGGGGAGGGGG - Intergenic
1186605118 X:11081487-11081509 CAGTATGTCTGGAGGGTGGCAGG + Intergenic
1195342469 X:103918895-103918917 CCATAGCTCTGCAGGGGAACAGG + Intronic
1195364347 X:104112716-104112738 CCGTAGCTCTGCAGGGGAACGGG - Exonic
1198204241 X:134451399-134451421 CCCTAGGCCTGGAGGAAAGCGGG + Intergenic
1200247713 X:154534772-154534794 CTGAAGGCCTGTAGGGGAGCAGG + Intronic
1200686833 Y:6265642-6265664 CCGTGGGTCTTGCAGGGAGCGGG - Intergenic
1200989711 Y:9336558-9336580 CCGTGGGTCTTGCAGGGAGCGGG - Intergenic
1200992380 Y:9356891-9356913 CCGTGGGTCTTGCAGGGAGCGGG - Intergenic
1200995031 Y:9377169-9377191 CCGTGGGTCTTGCAGGGAGCGGG - Intronic
1200997696 Y:9397515-9397537 CCGTGGGTCTTGCAGGGAGCGGG - Intergenic
1201002867 Y:9486361-9486383 CCGTGGGTCTTGCAGGGAGCGGG - Intronic
1201005523 Y:9506644-9506666 CCGTGGGTCTTGCAGGGAGCGGG - Intergenic
1201008186 Y:9526974-9526996 CCGTGGGTCTTGCAGGGAGCGGG - Intergenic