ID: 906967894

View in Genome Browser
Species Human (GRCh38)
Location 1:50477108-50477130
Sequence GTCACGCAGGTGAATTTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 50}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906967894 Original CRISPR GTCACGCAGGTGAATTTGGT TGG Intronic
902395459 1:16130129-16130151 GCCACCCAGGTGAAGCTGGTAGG - Intronic
905913429 1:41669298-41669320 GGCAGGCCTGTGAATTTGGTGGG + Intronic
906967894 1:50477108-50477130 GTCACGCAGGTGAATTTGGTTGG + Intronic
923158865 1:231300690-231300712 GCCAGGCAGGTGAATATGGCAGG - Intergenic
1064922951 10:20538172-20538194 GGCACGTATGTGAATGTGGTTGG + Intergenic
1065730841 10:28708240-28708262 GTCAGGGAGGTCAATCTGGTGGG + Intergenic
1071027769 10:81136764-81136786 GTGAAGCAGGGAAATTTGGTGGG - Intergenic
1088899636 11:114105534-114105556 GTCACTCAAGAGAATTGGGTCGG - Intronic
1092499042 12:9027854-9027876 GTCATGGAGGTGGTTTTGGTGGG - Intergenic
1095578106 12:43762584-43762606 GTTGCTGAGGTGAATTTGGTTGG + Intronic
1097743429 12:63271984-63272006 GTCATGGAGGTGGTTTTGGTGGG + Intergenic
1108429535 13:50340248-50340270 TTCATGTAGGTGATTTTGGTGGG + Intronic
1109525941 13:63576211-63576233 GTCACCCAAGTGAATCTGCTAGG - Intergenic
1115702618 14:35969532-35969554 GTCACTCAGGTGTTTATGGTGGG + Intergenic
1117578874 14:57130485-57130507 GTCTCACAGGAGAAATTGGTTGG - Intergenic
1118266361 14:64298340-64298362 GTCACCCATGTGCATTTGGTAGG + Intronic
1123200209 14:106656400-106656422 GTCACGCAGGAGAGTCTGGTGGG - Intergenic
1124377458 15:29137151-29137173 GTCACGCAGGTGGGGTTGGCAGG + Exonic
1151424830 17:74024278-74024300 GTCAGGCAGAGGAATTTGGTTGG - Intergenic
1151431595 17:74067206-74067228 GTAACTCAGGTGAAGTTGGGAGG + Intergenic
1156697975 18:39790988-39791010 GTCTAGAAAGTGAATTTGGTAGG - Intergenic
1159777324 18:72618878-72618900 GTCATGGAGGTGGCTTTGGTGGG + Intronic
1166286183 19:41830589-41830611 GTCATGGAGGTGGTTTTGGTGGG + Intergenic
1166593144 19:44019147-44019169 GGCACGCATGCTAATTTGGTAGG - Intergenic
926227379 2:10977973-10977995 GTCAGGCAAGTCAATGTGGTCGG - Intergenic
926603764 2:14876007-14876029 GTCACACAGGTAAATTTAATGGG + Intergenic
933256101 2:80082537-80082559 TCCAGGCAGGTGCATTTGGTCGG + Intronic
948469002 2:238165541-238165563 GTGTCGTAGGTGAAGTTGGTGGG + Intronic
1175153785 20:56955546-56955568 GTCACGCAGGTGCAAGTGGCAGG + Intergenic
1175184152 20:57168530-57168552 GCAACACATGTGAATTTGGTAGG - Intergenic
1181767336 22:25101226-25101248 GTCAGGCAGGGGAATTAGGTGGG + Intronic
949302973 3:2606023-2606045 GGGAAGCAGGGGAATTTGGTGGG + Intronic
950900489 3:16493051-16493073 AACAGGCAGGTGAATTTGGGTGG + Intronic
953655118 3:44845258-44845280 GTCATGGAGGTGGTTTTGGTGGG + Intronic
960878265 3:122318252-122318274 GTCATGGAGGTGGTTTTGGTGGG + Intergenic
964754934 3:160084303-160084325 GCCTGGCAGGTGAATATGGTAGG - Intergenic
964755392 3:160087147-160087169 GCCAGGCAGGTGAATATGGCAGG - Intergenic
967982919 3:195076405-195076427 GTCACGCAGGGGCCTTCGGTGGG + Intronic
973198198 4:47469714-47469736 GTCAAGGAGGTGAACTTGGCTGG + Intergenic
976466500 4:85375536-85375558 TTCATGCAGATGAATGTGGTTGG + Intergenic
979411932 4:120390025-120390047 GTCCTGCAGGTGAAATAGGTTGG + Intergenic
983989004 4:174095440-174095462 GTCACGCAGGTGAAGTGTGGTGG - Intergenic
986218936 5:5749489-5749511 GTCACGCAGGTGAATTCACTAGG - Intergenic
990867496 5:60396320-60396342 GTCAGGAAGGTGAACTGGGTTGG + Intronic
997030049 5:130117060-130117082 GTCACCCAGGTGAAGTTGGATGG + Intronic
997591789 5:135078007-135078029 TTCCTGCAGGTGGATTTGGTGGG + Intronic
1003055664 6:2817476-2817498 GTCAATGAGGTCAATTTGGTTGG + Intergenic
1017024652 6:150171026-150171048 GTCACGCCGGGGGAGTTGGTGGG - Intronic
1019510066 7:1413340-1413362 GTCACGCAGGAGAAAGTCGTAGG + Intergenic
1021983970 7:26081435-26081457 TACATGCAGATGAATTTGGTAGG + Intergenic
1024841376 7:53591143-53591165 GACACTGAGGGGAATTTGGTTGG - Intergenic
1038145636 8:24892847-24892869 GTCTGGTAGGTGAATCTGGTGGG + Intergenic
1041477821 8:58285288-58285310 CTCACGGAGGTGAATGTGGTGGG - Intergenic
1049142618 8:140969838-140969860 GTCACACAGGTGAATATAGAAGG - Intronic
1050628646 9:7535713-7535735 GTTACGCAGGTTACTTTGGTCGG - Intergenic
1051071073 9:13167987-13168009 TTCACACAGGTCAATTAGGTAGG + Intronic
1058559559 9:106211704-106211726 GTCATGGAGGTAAATTTTGTCGG + Intergenic
1194035773 X:88869545-88869567 GTCACGCAGGTGAGCTTGAGAGG + Intergenic
1195766598 X:108302968-108302990 GGCATGCAGGTCAATTTGTTGGG - Intronic