ID: 906968851

View in Genome Browser
Species Human (GRCh38)
Location 1:50489162-50489184
Sequence AGGGAATATACAGCCTGTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906968851_906968854 2 Left 906968851 1:50489162-50489184 CCTAGACAGGCTGTATATTCCCT 0: 1
1: 0
2: 2
3: 6
4: 131
Right 906968854 1:50489187-50489209 AAGATGTAATATCTTCTTATAGG 0: 1
1: 0
2: 1
3: 40
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906968851 Original CRISPR AGGGAATATACAGCCTGTCT AGG (reversed) Intronic
901672309 1:10863026-10863048 AGGGGGTTTGCAGCCTGTCTCGG + Intergenic
901911086 1:12458787-12458809 AGGGAAGAGGCAGCCCGTCTAGG - Intronic
904919560 1:33996448-33996470 AGGGAACAAACAGAATGTCTTGG + Intronic
906968851 1:50489162-50489184 AGGGAATATACAGCCTGTCTAGG - Intronic
911391109 1:97244931-97244953 TGGGATTATACAGTGTGTCTTGG + Intronic
914381145 1:147117569-147117591 AGGGAATATAGAGTCTACCTGGG + Intergenic
914842410 1:151259213-151259235 AGGGAATACTCAACCTGTCTAGG - Intronic
915318946 1:155045606-155045628 AGGGCATGGTCAGCCTGTCTGGG - Intronic
915972246 1:160363049-160363071 TGGGAAGGGACAGCCTGTCTTGG - Intergenic
916889323 1:169101310-169101332 AGGGAGTATACAGCCTCTGGAGG + Intergenic
917403949 1:174683338-174683360 AGGAAATACACAGCCTCTTTGGG + Intronic
918193387 1:182198316-182198338 AAGGTCTATACAGCCTCTCTTGG + Intergenic
919970047 1:202569990-202570012 AGGGAATATAGAGCTGGTCAGGG + Intronic
919988506 1:202692331-202692353 AGGCAAAATGCAGCCTTTCTTGG - Intronic
922936025 1:229422979-229423001 AGGGAATTTGCAACTTGTCTTGG + Intergenic
924126069 1:240853185-240853207 AGGGAAAATATTGTCTGTCTTGG + Intronic
1067674017 10:48354232-48354254 AGGGAAGGTACAGGATGTCTGGG + Intronic
1069743544 10:70700503-70700525 AGGGGACATATAGCCTGTCTGGG + Intronic
1074036198 10:109741354-109741376 ATGGAATATTCAGGCTGTCAGGG + Intergenic
1081654213 11:44846727-44846749 AGGGGAAATACAGCCTCTCCAGG + Intronic
1081929548 11:46859247-46859269 AGGGAATCTGCCTCCTGTCTGGG - Exonic
1083785152 11:64940764-64940786 AAGAAATATAGAACCTGTCTAGG - Intronic
1086934237 11:92727362-92727384 ATGGGAGATACAGCCTGTCAGGG + Intronic
1093108128 12:15114571-15114593 AGGTAATATAATGCCTGACTAGG + Intronic
1094625411 12:32118998-32119020 AGGGAAGAGACAGACTGGCTGGG + Intronic
1094783910 12:33823409-33823431 GGGAAATATTTAGCCTGTCTTGG + Intergenic
1101917583 12:108907807-108907829 ATGGAATATCCAGCATGTCCTGG - Intergenic
1107273394 13:38647637-38647659 TGGGAATTTACAGACTGACTGGG - Intergenic
1107792285 13:44014685-44014707 AGGGAATATCCTGTCTGCCTAGG + Intergenic
1114584072 14:23794108-23794130 AGGGAATCTTCTGTCTGTCTAGG - Intergenic
1117755488 14:58970435-58970457 AGGGACTTTCCAGCCTGACTGGG + Intergenic
1119785115 14:77307275-77307297 AGGGAATACACTGGCTGTGTGGG + Intronic
1121219259 14:92273931-92273953 GGGGAACATAAAGCCTATCTAGG - Intergenic
1124225454 15:27889708-27889730 AGGGAATGGGCAGGCTGTCTGGG + Intronic
1126583532 15:50262126-50262148 AGGGAAGACACAGCTTGTGTGGG + Intronic
1127314450 15:57781615-57781637 AGGGAATGGGCAGGCTGTCTGGG - Intronic
1131172573 15:90188962-90188984 AGAGAATATTCATCCTGGCTGGG - Intronic
1132234908 15:100212291-100212313 AGGGAATGTACAGCAAGCCTGGG + Intronic
1135740447 16:24970687-24970709 AGGTAGGAGACAGCCTGTCTGGG + Intronic
1137016703 16:35384270-35384292 AGGGAAGACACAACCTGCCTGGG + Intergenic
1141736778 16:85859466-85859488 AGGGGATTTCCAGCCCGTCTCGG + Intergenic
1142219635 16:88847580-88847602 AGGGCCCATGCAGCCTGTCTTGG - Intronic
1153588607 18:6649937-6649959 TGAGAATATACAGCATGGCTGGG - Intergenic
1153733755 18:8043367-8043389 GGGGATCACACAGCCTGTCTGGG - Intronic
1164254127 19:23512305-23512327 AGGGAAGAGACAGGCCGTCTGGG + Intergenic
1168035021 19:53712459-53712481 GGGCAATAGAAAGCCTGTCTTGG - Intergenic
925226987 2:2191720-2191742 TGCAAATATACAGCCTGTGTGGG + Intronic
925702787 2:6655564-6655586 AGGAAACAGACAGCCTGCCTCGG + Intergenic
927470198 2:23369231-23369253 AGGGCATATTCAGTATGTCTCGG - Intergenic
930642187 2:53864842-53864864 AGGGAAAAAACAGCCAGTCAGGG + Exonic
931983930 2:67723366-67723388 TGGGAATTGACAGCCTTTCTTGG + Intergenic
935343090 2:102075727-102075749 AGGGAATGTAAAGCATATCTTGG + Intronic
937756772 2:125548902-125548924 TGGAAATATACAGCCTCTCAAGG + Intergenic
938116699 2:128607197-128607219 AAGGAGTATACAGTGTGTCTGGG - Intergenic
938753300 2:134356169-134356191 AGAGAATATTCAGCATTTCTTGG + Intronic
938766392 2:134462983-134463005 AGGGACTTGACAGCCTGCCTGGG + Intronic
942832846 2:180257269-180257291 AGGGAAGATAAACCCTTTCTTGG - Intergenic
943344109 2:186717096-186717118 ATAGACTATACAGCCTCTCTGGG + Intronic
947329196 2:229010957-229010979 AGATAACATACACCCTGTCTAGG - Intronic
1172435509 20:34926301-34926323 AGGGACTATAGGGTCTGTCTTGG + Intronic
1173783169 20:45773392-45773414 AGGGGACAAACTGCCTGTCTTGG + Intronic
1174950424 20:55036002-55036024 AGGGAATATACCCTCTGGCTAGG - Intergenic
1179347125 21:40569001-40569023 GGGGGATAAACAGCCTATCTGGG - Intronic
1179564494 21:42238354-42238376 AGGGAGCATGTAGCCTGTCTTGG - Intronic
1181680104 22:24489302-24489324 AGGGCATAAACAGCCCCTCTGGG + Intergenic
1181979479 22:26755929-26755951 AGTGAATATAAAGCCGGTCAGGG - Intergenic
950243127 3:11389560-11389582 CGGGAAAATACCGCCTGTGTGGG + Intronic
954928843 3:54262116-54262138 AGCAATTATACAGCCTGTCGTGG - Intronic
955746191 3:62142646-62142668 AGAGAACACACAGCCTGTCAGGG - Intronic
957460552 3:80513288-80513310 AGGGAAGATACTGCCTCTCAAGG + Intergenic
960105776 3:113795092-113795114 AGTGGATATCCAGCCTATCTTGG + Exonic
964113868 3:153114955-153114977 AGGGAATATACTAGCTGTTTTGG + Intergenic
967004243 3:185368560-185368582 AGGGAGAGTATAGCCTGTCTAGG - Intronic
967904630 3:194489677-194489699 AGGCAACATACAGCCAGTCAAGG + Intronic
970111240 4:12640165-12640187 AGGGGATTTACAGCCTGTTACGG - Intergenic
971409627 4:26356275-26356297 AGTGCATGTGCAGCCTGTCTTGG - Intronic
972713818 4:41625719-41625741 ACGGAATTTGCAGCCTGGCTGGG + Intronic
973582927 4:52362055-52362077 AGCTAATATGCAACCTGTCTGGG + Intergenic
975292931 4:72697881-72697903 AGGGAATATAGAGCTTGACGTGG - Intergenic
976192541 4:82501848-82501870 AGGGAATATTCAACCTTTGTGGG - Intronic
981975549 4:150723565-150723587 AGGGAATATACCATGTGTCTTGG + Intronic
982568252 4:157014734-157014756 AAGGAATATATAGAATGTCTTGG - Intergenic
983658684 4:170109812-170109834 AGGTAAGATCCAGCCTGCCTTGG - Intergenic
985746682 5:1652147-1652169 AGGGAACTTCCACCCTGTCTGGG - Intergenic
988371532 5:30375542-30375564 AGAGAATATACAATCTGTTTAGG + Intergenic
989292584 5:39787015-39787037 AGAGAATATACAGCCGGGCGTGG - Intergenic
989542371 5:42632195-42632217 AGGGAAAATACAGTGTGCCTGGG - Intronic
990406126 5:55492891-55492913 AGGGAATATACGGCCTCCCATGG + Intronic
991426704 5:66499465-66499487 AAGGAATATCAAACCTGTCTGGG - Intergenic
991702811 5:69331915-69331937 AGGGAATATACAGTCAGTCTAGG - Intronic
992204196 5:74414409-74414431 AAGCAATAGACAGCATGTCTGGG - Intergenic
992429237 5:76691648-76691670 TGGGGATTTACAGGCTGTCTGGG - Intronic
993530013 5:89012755-89012777 AGGAAATACACATACTGTCTAGG - Intergenic
994201989 5:96987448-96987470 AGGGAATATACTGCTAGTTTTGG + Intronic
994470303 5:100195372-100195394 AGGGAATAAATAGCCTGTATCGG - Intergenic
995619905 5:114013620-114013642 AGTGAATAAGCAGCATGTCTGGG + Intergenic
995752726 5:115470787-115470809 AGGGAAAATACTGCCTCTCTGGG - Intergenic
996874648 5:128227375-128227397 AGGGAAGATACTGCTTTTCTGGG + Intergenic
997075686 5:130673289-130673311 AGGGAGTTTAGAGGCTGTCTGGG - Intergenic
1003337950 6:5192701-5192723 ACGGAATACACAGCCTGTTGTGG - Intronic
1005109766 6:22267654-22267676 AGTGAATATACAGGATGCCTAGG - Intergenic
1007384336 6:41510490-41510512 AGGGAAGAGCCAGCCTGGCTGGG - Intergenic
1010157623 6:72813085-72813107 AGTGAATAAACAGCATTTCTAGG - Intronic
1010444901 6:75938865-75938887 GGGGAATATTAAGGCTGTCTTGG - Intronic
1010778881 6:79920453-79920475 AAGGAATACTCAGCCTGTATAGG - Intronic
1013032342 6:106346154-106346176 AGAGAATTTACAGCCGGGCTCGG - Intergenic
1016636931 6:146303342-146303364 AGAGAATATTAAGGCTGTCTTGG - Intronic
1018062772 6:160103577-160103599 AGGGTATATATAACCTGTCACGG + Intronic
1019647453 7:2138713-2138735 AGGGTATGTGCAGCCTGCCTGGG - Intronic
1023644156 7:42292063-42292085 AGGGAATATACAATCTAACTAGG - Intergenic
1029087554 7:98023086-98023108 AGGCAATCTACAGCCGGGCTTGG + Intergenic
1030194593 7:106841156-106841178 ATGGAAAAAACAACCTGTCTAGG - Intergenic
1032482429 7:132257588-132257610 AGGGAATCTACATCCTGTCTTGG + Intronic
1036259771 8:7230245-7230267 AGGGAATACACAGCCTTTACCGG + Intergenic
1036311814 8:7688815-7688837 AGGGAATACACAGCCTTTACCGG + Intergenic
1037049254 8:14349409-14349431 AGAGAATCTAGACCCTGTCTAGG - Intronic
1037607359 8:20448972-20448994 ATGAAACATACAGCCAGTCTTGG - Intergenic
1040299887 8:46182466-46182488 TGGGGAACTACAGCCTGTCTGGG + Intergenic
1041605752 8:59780765-59780787 AGGGAAAGTGCAGCCGGTCTTGG + Intergenic
1043688460 8:83118500-83118522 AAATAATATACAGCCTGTATAGG - Intergenic
1045552997 8:103189487-103189509 AGGGAATAGACAGCCCAGCTGGG + Intronic
1046297375 8:112238360-112238382 AGGGAATACACAGCTTGTCATGG - Intronic
1047802026 8:128319676-128319698 AGGAAATATTCAACCTCTCTGGG - Intergenic
1050512275 9:6408563-6408585 AGGCAAGAGACAGCCTGACTTGG + Intergenic
1053732789 9:41074489-41074511 AGGGAATCTGCAGCCTGCCGGGG + Intergenic
1054695636 9:68357065-68357087 AGGGAATCTGCAGCCTGCCGGGG - Exonic
1056155208 9:83827664-83827686 AAGGAACATACAGCCTGTTGAGG - Intronic
1058285181 9:103168909-103168931 GGGAAAGACACAGCCTGTCTGGG - Intergenic
1060364932 9:123001850-123001872 AAGGATTATACAACCTCTCTGGG + Intronic
1060803684 9:126561709-126561731 AGGGAGTAGGCAGCATGTCTGGG - Intergenic
1061927513 9:133813167-133813189 ACTGAATACACAACCTGTCTGGG - Intronic
1186863384 X:13695048-13695070 ATGGAATCTACAGCCTTTCAGGG + Intronic
1187309481 X:18127702-18127724 AGGAAAAATAAAGACTGTCTCGG + Intergenic
1187469159 X:19552939-19552961 AGTGAATAGAGAGCCTGCCTGGG + Intronic
1188985697 X:36766646-36766668 ATGCAATATGCAGCCAGTCTTGG - Intergenic
1193332434 X:80249984-80250006 AGGAAATAGAAAGCCTGTCCAGG + Intergenic
1194810857 X:98385286-98385308 ACGGAAGATAAAGCTTGTCTTGG + Intergenic
1195073555 X:101304568-101304590 AGGGAATATCCTGCCTGTGTGGG + Intergenic
1195993123 X:110702999-110703021 AAGGAATTTACAGACTCTCTAGG - Intronic
1197189062 X:123624771-123624793 AGGGAATATACATTTTGACTAGG - Intronic