ID: 906970174

View in Genome Browser
Species Human (GRCh38)
Location 1:50505082-50505104
Sequence TATCTAACACTGCTGAAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906970174 Original CRISPR TATCTAACACTGCTGAAGAG TGG Intronic
904469158 1:30725331-30725353 TCTCTAACACTGGTGCAAAGGGG - Intergenic
905301213 1:36987390-36987412 TAGGAAACACTGGTGAAGAGAGG + Intronic
906912848 1:49973892-49973914 TATCTAACAGTACTGCAGAGTGG + Intronic
906970174 1:50505082-50505104 TATCTAACACTGCTGAAGAGTGG + Intronic
911880407 1:103231381-103231403 TATCCAAAACTGATGAAGATAGG - Intergenic
911977830 1:104524041-104524063 TATTTAACTATGCTTAAGAGAGG + Intergenic
919337622 1:196258465-196258487 TATCTATCAGTGTAGAAGAGTGG - Exonic
919555550 1:199047807-199047829 TTTCTAACAATGCTGAAAATAGG - Intergenic
921262542 1:213396679-213396701 TCCCTAACACTGCTGCACAGAGG - Intergenic
923872008 1:238005234-238005256 TATCTAACAGTACTGAAAACAGG - Intergenic
1064952828 10:20873163-20873185 AATGTAACACAGCAGAAGAGAGG + Intronic
1065464273 10:26002239-26002261 TATATAACAGTGCAGAGGAGAGG - Intronic
1067099032 10:43321458-43321480 GTTCTCACACTGCTGAAGAAAGG - Intergenic
1067964499 10:50894639-50894661 TATAGAAGGCTGCTGAAGAGTGG - Intergenic
1068318434 10:55378658-55378680 TATCTAAAACTGTTGAATTGAGG - Intronic
1069245156 10:66195244-66195266 TATATAACACTACTGAAAAGAGG + Intronic
1070210683 10:74317300-74317322 TATATAACACTGCTAAAAAGGGG + Intronic
1070313123 10:75287949-75287971 TATCTAACCATGCACAAGAGTGG - Intergenic
1071228651 10:83561316-83561338 GACCTTACTCTGCTGAAGAGAGG - Intergenic
1071752284 10:88493842-88493864 TTTCTACCACTGCTGACGACTGG + Intronic
1075090516 10:119441780-119441802 TATGTTCCACTCCTGAAGAGTGG + Intronic
1075746868 10:124734078-124734100 TCTCTAACTGAGCTGAAGAGAGG - Intronic
1076074852 10:127525174-127525196 TTTATAACACAGCTGGAGAGAGG - Intergenic
1076181366 10:128411455-128411477 TTTCTAACAGAGCTGTAGAGAGG + Intergenic
1077338998 11:2017710-2017732 TCTCTAACACTGCTGGAGGGCGG - Intergenic
1078472684 11:11604411-11604433 GATCCCACACTGCTGGAGAGTGG + Intronic
1079555892 11:21758456-21758478 TATTTAAGAATGCTGAATAGAGG + Intergenic
1080050048 11:27850502-27850524 TATCTTACAGTTCTGAAGATTGG + Intergenic
1080502586 11:32885015-32885037 TATCTCACAGTTCTGAAGACTGG - Intergenic
1081227748 11:40545602-40545624 TATCTAACACAGCAATAGAGGGG - Intronic
1082740586 11:56906605-56906627 TATCTTACACTGGTGAAGAGAGG - Intergenic
1083817856 11:65147161-65147183 TAACTAACACTGCAGAAAAGTGG - Intergenic
1085809014 11:79663558-79663580 ATTCTAACAATGCAGAAGAGTGG - Intergenic
1086851371 11:91813073-91813095 TATCTAACGGTCCTGAAAAGTGG - Intergenic
1090203734 11:124873682-124873704 TATCTCCCACTGCAGAAGACTGG + Exonic
1090604774 11:128410166-128410188 TATCAAAAACTGATTAAGAGAGG - Intergenic
1202821982 11_KI270721v1_random:72892-72914 TCTCTAACACTGCTGGAGGGCGG - Intergenic
1093539012 12:20258312-20258334 TATCCAAGACTGCTTAAGAAAGG - Intergenic
1095457454 12:42403846-42403868 TACCTAACACTGGTAGAGAGTGG - Intronic
1096347756 12:50865373-50865395 TATTAGACACAGCTGAAGAGAGG + Intronic
1097961969 12:65541141-65541163 TATGTGGCACTGCAGAAGAGGGG - Intergenic
1098227177 12:68336518-68336540 CAACTAACATTGCTGAAGATCGG + Intergenic
1100253267 12:92854477-92854499 GATGTAATACTACTGAAGAGAGG - Intronic
1103963464 12:124623476-124623498 TACCTCCCACTGCTGGAGAGTGG + Intergenic
1105466558 13:20647643-20647665 TACCTAATGCTGCTGAAGAATGG - Intronic
1108809441 13:54203170-54203192 CATCACATACTGCTGAAGAGTGG - Intergenic
1116563079 14:46407867-46407889 TATCTAACAGAGCTGAAAAGAGG - Intergenic
1117710914 14:58527544-58527566 TATTTAAGACTGCTGAATATTGG - Intronic
1118553641 14:66986996-66987018 TCTCTAACACTGCTTTATAGTGG + Intronic
1119077316 14:71654567-71654589 TTTATAACACTGCTGAAAAATGG - Intronic
1120281834 14:82448815-82448837 TTTCTCACACTGCTGAAAAGTGG - Intergenic
1121896803 14:97656322-97656344 TTCCTAATACTGCTGCAGAGTGG + Intergenic
1126822723 15:52520674-52520696 TGACTAACACTGTTAAAGAGAGG + Intronic
1127337870 15:58008050-58008072 TATCTAAAACTGGAAAAGAGAGG + Intronic
1129003578 15:72353872-72353894 TTTTTAACACTGATGAAAAGGGG + Intronic
1129224397 15:74159016-74159038 TACATAACACTGCTAAAAAGAGG + Intergenic
1129864380 15:78893077-78893099 TATTTGACAATGCTGATGAGAGG + Intronic
1130162822 15:81418628-81418650 TTTCTCACACTTCTGAAGACTGG - Intergenic
1130215884 15:81969121-81969143 TTTCTCACACTGCTGGAGACTGG + Intergenic
1132657072 16:1045867-1045889 TACCTAACACTGCTGCAGGGAGG + Intergenic
1138321057 16:56112250-56112272 TATCTAACACAGATGACGATGGG - Intergenic
1139935191 16:70565385-70565407 TTTCCAACACTGGTGAAGACTGG + Exonic
1146778896 17:35649023-35649045 AATCAAAAACTGCTAAAGAGAGG - Intronic
1148627064 17:49077727-49077749 TATGTAAAACTGGTGAAGTGTGG - Intergenic
1150176973 17:63067396-63067418 TATGTTACACTTCAGAAGAGAGG - Intronic
1155671845 18:28380644-28380666 TATCCAACCCTGGGGAAGAGAGG + Intergenic
1159132898 18:64300836-64300858 TTTCTAAGACTGGAGAAGAGTGG - Intergenic
1159790184 18:72768863-72768885 TATCTTACACTTCTGGAGTGCGG - Intronic
1160940757 19:1619463-1619485 TATCTTACTCTGCTGCAGGGTGG + Exonic
1161631147 19:5356311-5356333 AATCCAACCCTGCTCAAGAGAGG + Intergenic
1164489111 19:28690497-28690519 TCACTAATACTGCTGCAGAGAGG - Intergenic
926738909 2:16094901-16094923 CCACTAACAGTGCTGAAGAGTGG + Intergenic
934715732 2:96542232-96542254 CATCTAATGCTGCAGAAGAGGGG + Intronic
940442464 2:153734192-153734214 TGTCTTACAGTGCAGAAGAGAGG - Intergenic
941158192 2:162003855-162003877 TAACTAACAGTACTGAAGAGGGG + Intronic
944036291 2:195298290-195298312 TTTCTTACAGTTCTGAAGAGTGG - Intergenic
944301726 2:198131314-198131336 TACCTAACTCTGTTGAAGATGGG - Intronic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1173265480 20:41475744-41475766 TATCTAACTCTGATGACTAGGGG - Intronic
1174126026 20:48307232-48307254 TCTCTAACACTGCTGGTGGGGGG - Intergenic
1174892753 20:54414708-54414730 TATCTAAAACAGCAGAAGATTGG - Intergenic
1176166333 20:63675945-63675967 TAACTAACAAAACTGAAGAGTGG - Intronic
1179182254 21:39055331-39055353 AATCACACACTGCTCAAGAGTGG + Intergenic
1183976087 22:41513132-41513154 TCCCTAACCCTGCTGCAGAGAGG - Intronic
949637199 3:5995910-5995932 TATCCAAAAGGGCTGAAGAGAGG - Intergenic
952234032 3:31460703-31460725 TTTCTAACAGTGCTGGAGACTGG + Intergenic
952571092 3:34717326-34717348 TATGTAAAAATGCTGAAGTGAGG + Intergenic
953448588 3:42988158-42988180 TGACTACCACTGCTGGAGAGTGG + Intronic
955944559 3:64180348-64180370 TATTTAATGCTGCTGAAAAGTGG - Intronic
956754423 3:72371020-72371042 TATCAATCTCTGCAGAAGAGGGG + Intergenic
957146251 3:76427890-76427912 TGTCTAAAACTGGAGAAGAGAGG - Intronic
958978479 3:100693411-100693433 TATCTAACACATCAGAAGAAAGG - Intronic
959240016 3:103779102-103779124 TTTCTCACAATGCTAAAGAGTGG - Intergenic
959979848 3:112503719-112503741 TATCTCACAGTTCTGAAGAGTGG - Intergenic
962201615 3:133404842-133404864 GTTCTAACACAGCTGAGGAGTGG - Intronic
963318208 3:143783889-143783911 TTTCTAAAACAGTTGAAGAGAGG - Intronic
963360494 3:144266591-144266613 CAATTAACTCTGCTGAAGAGAGG + Intergenic
965209775 3:165770028-165770050 TTCCTGACATTGCTGAAGAGGGG - Intergenic
965842178 3:172918912-172918934 TATATTATACTGCTGAAAAGCGG + Intronic
969317746 4:6392266-6392288 TATGCAACAGTGCTGAGGAGAGG - Intronic
970725612 4:19040816-19040838 GATCTCACAGTGATGAAGAGTGG - Intergenic
973584853 4:52379411-52379433 TATCTAAGAATGCTGAATATTGG - Intergenic
974334503 4:60523682-60523704 TATCTAACACTGCTCAAGGAAGG + Intergenic
974434807 4:61843296-61843318 GTTCTAACACTGCAGAAGAAAGG - Intronic
974633800 4:64532076-64532098 TATCTAACACTGCTCAAATGTGG + Intergenic
975429043 4:74266830-74266852 AATCTAAGACTGCATAAGAGGGG + Intronic
975554039 4:75642034-75642056 TATCTCACACTGTTGAAAATAGG - Intergenic
978768965 4:112433605-112433627 TGTCTAACACAGCTTAAAAGTGG + Intronic
979902076 4:126234291-126234313 TCTGTAAGACTGCTGAAGATTGG + Intergenic
980225870 4:129984756-129984778 AATCTGACACTGCTTAAAAGGGG + Intergenic
986875419 5:12101772-12101794 TATGTAACTGTGCTGAATAGTGG - Intergenic
987790129 5:22554591-22554613 TATCTAAAACTACTGGTGAGTGG + Intronic
992008233 5:72500402-72500424 GATCTAACAAAGCTGAAGAGGGG - Intronic
995670631 5:114598615-114598637 TGTCTGACAGTTCTGAAGAGAGG + Intergenic
997802727 5:136882693-136882715 TATCTAACTCTACTGAATGGGGG + Intergenic
998154478 5:139776601-139776623 TGTCTAACATTGGTGAATAGAGG - Intergenic
1001847162 5:174932540-174932562 TTTCTCACACTGCTGGAGACTGG + Intergenic
1003331292 6:5130610-5130632 CTTCTAAAACTGCTGAGGAGAGG + Intronic
1004616360 6:17294231-17294253 TCACTAACATTGCTGAAAAGTGG - Intergenic
1006856659 6:37138247-37138269 TATCTAAAAATGCTAAAGAGGGG - Intergenic
1008011828 6:46475997-46476019 TAAGTAACACTGGTGAAGAAGGG + Intronic
1008144054 6:47868141-47868163 GATCTAAAACTGTTGAAGAAGGG - Intergenic
1009583545 6:65567212-65567234 TTTCTGACAGTTCTGAAGAGTGG - Intronic
1010002039 6:70957340-70957362 TATTTCACAAAGCTGAAGAGAGG - Intergenic
1011843490 6:91531669-91531691 TATCAAACAGTGCAGAAAAGGGG - Intergenic
1013510680 6:110841682-110841704 TATCTAACACACCTGAATAAAGG - Intronic
1013631656 6:111991769-111991791 TAGGTAACAGAGCTGAAGAGTGG + Intergenic
1014764540 6:125391599-125391621 TATATATCACTGGTGAAGATCGG - Intergenic
1015723498 6:136272416-136272438 TATCTAAAAATACTGAAGACAGG - Intronic
1015982557 6:138853761-138853783 TATCTTACCCTGCTGCACAGTGG + Intronic
1016702476 6:147069305-147069327 TATGTAAAATAGCTGAAGAGTGG - Intergenic
1023599336 7:41865715-41865737 TATGTAACACAGGTGAAGGGTGG + Intergenic
1025618195 7:63142799-63142821 TATGTAAAACAGCTGAAGGGTGG - Intergenic
1026440243 7:70437883-70437905 CTTCTACCACTGCTGAAGACTGG - Intronic
1028051397 7:86192309-86192331 TATCTAATACTGTTGTAGTGTGG + Intergenic
1028285229 7:88988707-88988729 TTTTTAAAACTGCAGAAGAGGGG + Intronic
1028373683 7:90121855-90121877 TATCAAGCCCTGCTGCAGAGAGG + Intergenic
1029832657 7:103277828-103277850 TATCAAGCCCTGCTGCAGAGAGG - Intergenic
1030213195 7:107016639-107016661 TATCTGACAATGATGAAGAGGGG - Intergenic
1035108878 7:156463957-156463979 TTTCTAACGCTGCTGCTGAGTGG + Intergenic
1037962560 8:23109235-23109257 TATTAAAAACTGCTGAAGTGTGG + Intronic
1038249575 8:25890621-25890643 TATCTCACAGTGCTGAAATGAGG + Intronic
1041555950 8:59156154-59156176 TATCAAACACTAATGTAGAGGGG + Intergenic
1051315841 9:15830770-15830792 TTTCAAACACTGGTTAAGAGTGG + Intronic
1054945599 9:70792761-70792783 TATCTACCCCTGGTGAATAGGGG - Intronic
1058268508 9:102937976-102937998 TATTTAAGAAGGCTGAAGAGGGG + Intergenic
1187360150 X:18618457-18618479 TAAGGAACACTGCAGAAGAGTGG - Intronic
1189694574 X:43651361-43651383 TATCTAGCACAGCTGAAGCGAGG - Intergenic
1194520441 X:94912226-94912248 TATCTAACACTGATCATTAGAGG + Intergenic
1197623003 X:128772220-128772242 AAACTAAGAGTGCTGAAGAGTGG + Intergenic
1197627358 X:128817085-128817107 TTTCTAACATAGCAGAAGAGTGG - Intergenic
1198023775 X:132684697-132684719 CAGATAACACTGCTGATGAGAGG - Intronic
1200772791 Y:7142698-7142720 TATCTATCACTGCAGAGGTGTGG + Intergenic