ID: 906971548

View in Genome Browser
Species Human (GRCh38)
Location 1:50519777-50519799
Sequence AGTATCTTCTAGAAGAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 319}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906971548 Original CRISPR AGTATCTTCTAGAAGAAAGA AGG (reversed) Intronic
901131857 1:6966916-6966938 AGTATCTTTTACAATAAAAAAGG - Intronic
901512676 1:9725245-9725267 AATATCTTTTAGAAGGCAGAGGG - Intronic
901568623 1:10140749-10140771 AGTATCTTCTAGGACATAGTTGG + Intronic
902137577 1:14323404-14323426 GGTATTTTATATAAGAAAGAAGG - Intergenic
902146775 1:14408353-14408375 AGTATCTACTAGATGAATGAAGG - Intergenic
905309145 1:37037450-37037472 AATATGTTTTAGAAGAAAGTAGG - Intergenic
906273240 1:44497821-44497843 AGCAACTTCCAGCAGAAAGAGGG - Intronic
906863960 1:49395303-49395325 AGTATCAACTTGAAGAAAAAGGG + Intronic
906971548 1:50519777-50519799 AGTATCTTCTAGAAGAAAGAAGG - Intronic
907578069 1:55546488-55546510 AGTAACCACTACAAGAAAGATGG + Intergenic
908987073 1:70037414-70037436 AGTATCTGCTAGAAATAACATGG + Intronic
911363643 1:96910462-96910484 ATTATCTTCTAGACTAAAGTAGG - Intergenic
911786184 1:101950782-101950804 AGTATCCTCTATAAGAACAAGGG + Intronic
911922293 1:103780677-103780699 CGTTACTTATAGAAGAAAGAGGG + Intergenic
912020386 1:105102377-105102399 GGAATCTACTAGAAAAAAGAAGG + Intergenic
913671548 1:121101165-121101187 ATTATTTTCTAAAATAAAGATGG - Intergenic
914023321 1:143888601-143888623 ATTATTTTCTAAAATAAAGATGG - Intergenic
914661802 1:149796541-149796563 ATTATTTTCTAAAATAAAGATGG - Intronic
914920639 1:151845037-151845059 TGAAACTTTTAGAAGAAAGAGGG - Intergenic
915652830 1:157331503-157331525 AATATCTTCTAAAAGAAAAGGGG + Intergenic
915970299 1:160350204-160350226 TTCATCTTCAAGAAGAAAGATGG - Exonic
916258505 1:162815721-162815743 AATATCTTCCAGAATATAGAAGG - Intergenic
917360360 1:174168656-174168678 GGTAACTTCTAGAATACAGAAGG - Intronic
917667748 1:177241574-177241596 ATTTTCTTCATGAAGAAAGATGG - Intronic
917736497 1:177925874-177925896 ATTCTTTTCAAGAAGAAAGAGGG + Intronic
918406783 1:184219297-184219319 AGTGTCTTCTAAGAGTAAGAAGG + Intergenic
918937845 1:190947132-190947154 AGTATCATCTATAAGAAAGTAGG - Intergenic
920004036 1:202819759-202819781 ATTATCTTCCAGCAGGAAGAAGG - Intergenic
921068613 1:211640538-211640560 AGTAACTTTTAGTAGAAAGAAGG - Intergenic
922386043 1:225084200-225084222 ATTATCTTCAAGAAGAAGAAGGG - Intronic
922437319 1:225619368-225619390 AGTATTTTTTAGTAGAAACAGGG - Intronic
923906333 1:238389246-238389268 AGAATCTTCTGGATGAAAGCAGG + Intergenic
924100721 1:240600091-240600113 AGTATGGTGTAGTAGAAAGAAGG + Intronic
924135960 1:240967347-240967369 AGTAGCTTCTAAAAGACACAAGG + Intronic
1063765962 10:9140757-9140779 AGAATCTTCTCAAAGAGAGAGGG - Intergenic
1066307853 10:34163821-34163843 AGGATCTACTGGAAGAAGGAAGG + Intronic
1067967644 10:50930901-50930923 ACTAATTTCCAGAAGAAAGAGGG - Intergenic
1068322424 10:55437119-55437141 TGTAGCTTCTAAAAGGAAGATGG - Intronic
1068745245 10:60522920-60522942 AACCTCTTCTACAAGAAAGATGG + Intronic
1068904817 10:62310925-62310947 ACTATCTTGTAGAAAAATGAAGG + Intergenic
1070056923 10:72944462-72944484 AGTAAATTCTACAAGAAAAATGG + Intronic
1070745995 10:78934269-78934291 AGCAGCTTCTGGGAGAAAGATGG - Intergenic
1070996564 10:80788729-80788751 AGTTTCTTCTAGAAGAATGAGGG + Intergenic
1072199995 10:93149700-93149722 AGAGTCTTCCAGAAGAAACACGG - Intergenic
1074451183 10:113561090-113561112 AGTGTCTTCTAGGATAAAGTTGG + Intronic
1075859133 10:125659653-125659675 ACTGTAGTCTAGAAGAAAGAGGG + Intronic
1076569009 10:131420204-131420226 AGGATCTACTAATAGAAAGAGGG + Intergenic
1076604764 10:131682302-131682324 AGTTCCTTCTAGAAGTAAGATGG + Intergenic
1080315510 11:30943368-30943390 AGTAGCTACCAGAATAAAGAGGG - Intronic
1081095868 11:38934428-38934450 TGTTTCTTTTAGAAAAAAGAAGG + Intergenic
1083604337 11:63968838-63968860 AGTATCTTATATCAGGAAGAGGG + Intergenic
1083953492 11:65969894-65969916 TGTATTTTTTAGAAGAAACAGGG + Intronic
1084854360 11:71972643-71972665 AGTATCATCTAGTGGACAGAGGG - Intronic
1085537949 11:77236856-77236878 AGTTGCTGCCAGAAGAAAGAAGG + Intronic
1085911816 11:80835774-80835796 ATTATCTTCTAAAAGACAAAAGG + Intergenic
1087126337 11:94629707-94629729 ATTATTTTCTAAAAGAATGAAGG + Intergenic
1087342919 11:96931533-96931555 AGTAGCATATAGAAAAAAGAGGG - Intergenic
1087915591 11:103806120-103806142 AGTTTATTTTAGAAGACAGAAGG + Intergenic
1088253102 11:107878610-107878632 AGTATCTTAAAAAACAAAGAGGG - Intronic
1088898206 11:114093663-114093685 TGGAGCTTGTAGAAGAAAGATGG + Intronic
1090161300 11:124498416-124498438 TGTAACTTCAAGAAGAAAAAGGG + Intergenic
1091083384 11:132694632-132694654 AGGTTCTCTTAGAAGAAAGAAGG - Intronic
1091166228 11:133478587-133478609 CGTAACTTCTGGAAGAAAGATGG - Intronic
1091346998 11:134861764-134861786 AGTACCTTTTAGAAAAAAGTGGG - Intergenic
1092112315 12:5972317-5972339 AGGACCTTCTAGAGGCAAGATGG - Intronic
1092236904 12:6816073-6816095 AGCATAGTCTATAAGAAAGAGGG + Exonic
1092307545 12:7317032-7317054 ACTATCTTCTGGTAGCAAGAGGG + Intronic
1092577757 12:9807373-9807395 AATATCTTAAAGAAGAAATAAGG - Intergenic
1095715506 12:45342021-45342043 AGTTTCATCTAAAAGATAGAGGG - Intronic
1095987170 12:48006131-48006153 AATCTCTGCTAGAAGAAAGCTGG + Intergenic
1098182046 12:67857691-67857713 AAAATATTCTACAAGAAAGAAGG + Intergenic
1098578626 12:72072339-72072361 AGTATTTTCTTGGAGAGAGAGGG - Intronic
1098917179 12:76269637-76269659 AGTATTTCCTTGATGAAAGAGGG + Intergenic
1099829256 12:87818804-87818826 AGTATTCTCCAGAAGAGAGATGG - Intergenic
1101201628 12:102442321-102442343 AGTATCTTCTAAGAGAAACTTGG + Intronic
1101637407 12:106556137-106556159 AGTATCTTCTAAAGAAAAAAAGG - Intronic
1102650426 12:114438421-114438443 AGGAGCTCCTAGAACAAAGATGG + Intergenic
1102949383 12:117019821-117019843 ATTACCTTGGAGAAGAAAGAGGG - Intronic
1103513121 12:121488978-121489000 TGTATTTTTTAGAAGAGAGAGGG + Intronic
1103721932 12:122979841-122979863 AGCATCTTCTAGATGGCAGAGGG + Exonic
1104433514 12:128736519-128736541 AATATCTTTAAGAAGAAAAATGG + Intergenic
1104526546 12:129529280-129529302 AGTATCTTCTTTAAGAAACGAGG - Intronic
1104565870 12:129882224-129882246 AGTCTCTTCCAGAAAATAGAAGG + Intronic
1105060335 12:133144469-133144491 AGTATCATCAAGAACAAGGAGGG + Exonic
1106405457 13:29469323-29469345 AGTAAATTCTTTAAGAAAGAAGG + Intronic
1106696296 13:32177415-32177437 ATTATTTTTTAGAAGAAACAGGG - Intronic
1107183556 13:37490680-37490702 AGTATCTTATTGAAGAATGTTGG + Intergenic
1107258076 13:38455171-38455193 AGTATCAGCAAGAAGAAAAATGG + Intergenic
1107583211 13:41814969-41814991 AGAATCTTAAAGCAGAAAGAGGG + Intronic
1107893268 13:44932762-44932784 AGTATCTTCTAGAAACACGCAGG + Intergenic
1108438509 13:50425392-50425414 AGTATTTCCTAGGAGTAAGAAGG - Intronic
1108570315 13:51743240-51743262 AGAATCTTCTCAAAGACAGAAGG + Intronic
1108745302 13:53387447-53387469 AGTATCTTATACAAGACACAAGG - Intergenic
1109019248 13:57064348-57064370 ATTATCTGCTAGAATAAGGAAGG - Intergenic
1109232900 13:59780858-59780880 AGTAACTTCTGGAAGACAGCTGG + Intronic
1110820173 13:79906645-79906667 AGTTTCTTATAGATGAAACATGG - Intergenic
1111080753 13:83303840-83303862 AGTATTTTCTAGAAAAGATATGG - Intergenic
1111084107 13:83351628-83351650 ATTATCTTCTTGAAGACAGAGGG + Intergenic
1112657008 13:101462077-101462099 AGTAGCTTCTAGAAGACAAGAGG - Intronic
1114515788 14:23299449-23299471 ACAGTCTTCTAGAAGAGAGAAGG - Exonic
1115256745 14:31410773-31410795 AGTATTTTATTGTAGAAAGAAGG - Intronic
1115339716 14:32280177-32280199 ATTATCATCTTGAAGAAAAAAGG - Intergenic
1115445220 14:33482200-33482222 AGTCTCCTCTAGAATTAAGAAGG + Intronic
1116135406 14:40916932-40916954 ATTATTTTCTAGAAAAAAAATGG - Intergenic
1117990883 14:61432378-61432400 AGAATCTACTTGAAGAAGGAGGG - Intronic
1118284545 14:64459763-64459785 AGTAGCTTCTTGAAGATGGATGG - Exonic
1119752972 14:77093564-77093586 AGTATCAGCAAGAAGACAGAGGG + Intergenic
1124016701 15:25883054-25883076 AGAAATTTCTAGAAAAAAGATGG - Intergenic
1126056610 15:44735735-44735757 AATATCTTCTACAAGAGACAGGG + Intronic
1128658061 15:69477082-69477104 AGTGTCTTCTGGCAGCAAGATGG - Intergenic
1128995066 15:72289503-72289525 AGGATCTTTGAGAGGAAAGATGG + Exonic
1129918479 15:79296158-79296180 AGCATCATATAGAGGAAAGAGGG + Exonic
1130173386 15:81541167-81541189 TGTATGTTCTACAAGAAGGATGG - Intergenic
1130829518 15:87585049-87585071 TGTATCATTTAGAGGAAAGAAGG + Intergenic
1131530785 15:93190034-93190056 ATTATCTTCTAGTAGAACAATGG + Intergenic
1133539861 16:6739570-6739592 AATATCTTCTAGAAAATAGAAGG + Intronic
1133712470 16:8414574-8414596 AGAAACGTCCAGAAGAAAGAAGG - Intergenic
1134429121 16:14184786-14184808 AGCATATTCTAGAAGACAGAAGG + Intronic
1137882504 16:52065993-52066015 AGTTTCTTCCAGAAAACAGAAGG - Intronic
1138671084 16:58615127-58615149 AATATCTTCTAGAGGTAAGTGGG + Intronic
1139227111 16:65243225-65243247 AGTATCTTCTAAAAGTAACCTGG - Intergenic
1139297507 16:65915938-65915960 TGTATCTTATAGAAGAAAAATGG + Intergenic
1140667859 16:77244169-77244191 AGTATTTTCCCGAAGAATGAGGG - Intergenic
1141075482 16:81002987-81003009 AATATGTGGTAGAAGAAAGAAGG - Intronic
1141300697 16:82812854-82812876 AGTATCTCCTACAGGAAAGAAGG - Intronic
1141350119 16:83286998-83287020 ATTATCTTCCAGATGAAAGGAGG - Intronic
1141353960 16:83325727-83325749 AGAATCTTCTAGGAGAACAAAGG - Intronic
1145020109 17:19423507-19423529 AGGGTGTTCTAGAGGAAAGATGG - Intergenic
1146413144 17:32606299-32606321 CCTATTTTCTAGAAGAAATATGG - Intronic
1148141547 17:45332789-45332811 AGAAGTTTCTAGAAGAATGAAGG - Intergenic
1149185057 17:53988185-53988207 AGTATCATTTAGCAGAAAGAGGG - Intergenic
1149417878 17:56479238-56479260 AGTTTCTGCTAGAAGGATGAAGG - Intronic
1149854444 17:60067922-60067944 ACTGTCTACTATAAGAAAGAAGG + Intronic
1151152756 17:72101917-72101939 AGCACTTTCTAAAAGAAAGAAGG - Intergenic
1151315619 17:73320276-73320298 AGACTCTTCTAGAAGAAAATGGG + Intergenic
1153100634 18:1465081-1465103 ACTGTCTTCAAAAAGAAAGAAGG + Intergenic
1153180302 18:2425464-2425486 AGTTTGTTGTAGAAGAATGAGGG - Intergenic
1154078641 18:11232067-11232089 AGTAACATCTAGAAAAAAAAAGG + Intergenic
1155376409 18:25163345-25163367 AGTATTTTTTATAACAAAGATGG + Intronic
1155586212 18:27368889-27368911 AATAGCTTCTAGAAGAGAAAAGG + Intergenic
1155832829 18:30539550-30539572 TATATATTCTACAAGAAAGAGGG - Intergenic
1156223029 18:35073321-35073343 AATATTTTCTAGAACAATGAAGG - Intronic
1156728701 18:40162549-40162571 AGTGTTTTCTTTAAGAAAGATGG + Intergenic
1156897998 18:42268744-42268766 AGTATCATCTAGAGGAAAGATGG + Intergenic
1156937546 18:42728995-42729017 ATTAGCTTCTAGAAGGTAGAAGG + Intergenic
1157303261 18:46496434-46496456 AGAGTCTTCTACAATAAAGATGG - Intronic
1158587406 18:58753377-58753399 AGTATCTACTAAAATAAACAGGG + Intergenic
1159318879 18:66819484-66819506 AGCATCTTGTAGAAACAAGAAGG - Intergenic
1159631449 18:70753205-70753227 AGTATTTCCAAGAAGTAAGAGGG - Intergenic
1161999457 19:7734082-7734104 AGGATTTTGTAAAAGAAAGATGG + Intergenic
1164533765 19:29068627-29068649 AGTATTTTCTTGAAGACAAATGG - Intergenic
1166656982 19:44619501-44619523 ACTATCTTCTAAAAGGAGGATGG - Intronic
1166730282 19:45055462-45055484 GGTATCTGCTAGAACAAGGAAGG + Intronic
925107369 2:1304052-1304074 AATATCTTCTAGAAGAAAAAAGG + Intronic
925191436 2:1887565-1887587 AGGAGGCTCTAGAAGAAAGACGG - Exonic
925239434 2:2310888-2310910 AATATCTTTCAGCAGAAAGAGGG + Intronic
925835279 2:7939101-7939123 GGTAGCCTCTACAAGAAAGACGG + Intergenic
925864951 2:8219494-8219516 AGTATCGTTTTCAAGAAAGAAGG + Intergenic
926748432 2:16179481-16179503 ATTACCATCTAGAAAAAAGAAGG - Intergenic
928574246 2:32638680-32638702 AGTATTCAATAGAAGAAAGAAGG - Intronic
929535347 2:42779659-42779681 AGTCTCTTCTCAAAGAATGAAGG + Intronic
930133334 2:47875459-47875481 AGAATCTCCTAGAAGGAAGATGG - Intronic
930133406 2:47876574-47876596 AGTGTCTTCCAGAAGATAAAAGG - Intronic
930841523 2:55852533-55852555 AAGATCTTCTACCAGAAAGAGGG + Intergenic
931230663 2:60372003-60372025 AGCCACTTGTAGAAGAAAGATGG + Intergenic
932466638 2:71928395-71928417 AGTGTCTTCTAGAATTGAGAGGG - Intergenic
932732816 2:74232735-74232757 AGTATCTTCTGGAAGGCAGGGGG - Intronic
933335816 2:80957535-80957557 ACTAACTCCTAGAAGAAATATGG - Intergenic
934737179 2:96695491-96695513 AGGATCTACCAGAACAAAGAAGG - Intergenic
935789814 2:106580651-106580673 AGTATTTTAAAGAAAAAAGATGG - Intergenic
937107253 2:119328162-119328184 AGATTCTTCCAGAAGAAGGATGG - Intronic
937760957 2:125603162-125603184 AGTAATTTATAGATGAAAGAGGG - Intergenic
937790735 2:125958221-125958243 AGTATTTTCTGGATGAGAGAAGG - Intergenic
937799798 2:126070304-126070326 AGCAGCTTCTAGTAGAAGGATGG + Intergenic
940101947 2:150050424-150050446 AATATCTTCTTCAAGGAAGAGGG - Intergenic
940176727 2:150885755-150885777 AATATATTACAGAAGAAAGAAGG - Intergenic
940236928 2:151521643-151521665 AGTATCTTCTAAAAGACAGAAGG - Intronic
943201705 2:184835380-184835402 AGTAATTTCTAGAAAAAGGATGG + Intronic
943280969 2:185932680-185932702 AATGTCTTCTAAAAGAGAGAGGG + Intergenic
943469068 2:188270191-188270213 ATTATCTTCAAAAAGAAAAAGGG - Intergenic
943480903 2:188416036-188416058 ACTATCATCTAGAATAAAGTGGG + Intronic
946942752 2:224786771-224786793 TCTAACTTCTTGAAGAAAGAGGG - Intronic
947014806 2:225607431-225607453 AGAATGTTCTTGAAGAAAGGAGG - Intronic
948930248 2:241127313-241127335 AGGATCTTCTGGGAGAAAGCAGG - Exonic
949062866 2:241971385-241971407 TTTATCTTCTTGCAGAAAGATGG - Intergenic
1170436337 20:16333566-16333588 AGTATTTTCCAGAGGAAAAAGGG - Intronic
1171358009 20:24565570-24565592 TGTTTCTTCTAGAAAATAGAGGG + Intronic
1171562597 20:26138426-26138448 ATTATATACTAGAGGAAAGAAGG + Intergenic
1172287206 20:33749138-33749160 AGAATCTTGTAGAATAAAGGGGG + Intronic
1173132455 20:40407677-40407699 AGAATCTACAATAAGAAAGAAGG + Intergenic
1173366556 20:42391108-42391130 AGAATTTTTTAGAGGAAAGAGGG + Intronic
1173430376 20:42982585-42982607 AGGAGCTTCTAGAAGTCAGAAGG + Intronic
1173690682 20:44958867-44958889 AGAGTTTTCTAGAACAAAGAAGG + Intronic
1173960335 20:47066452-47066474 AATGTCTTCAACAAGAAAGAAGG + Intronic
1174965798 20:55213385-55213407 AGTACGTTCTATAAGGAAGAAGG + Intergenic
1175473242 20:59249114-59249136 AGGATATTCTAGACAAAAGAAGG - Intronic
1175493507 20:59395438-59395460 AGTATCCTACACAAGAAAGAAGG + Intergenic
1175510771 20:59524082-59524104 AGTTTCTTCCAGAAGATAGAAGG + Intergenic
1175594438 20:60219604-60219626 ATGATCTTCTAGGTGAAAGATGG + Intergenic
1177458373 21:21374983-21375005 AGAAACTTCTAAAAGAAAAAAGG + Intronic
1178517373 21:33259238-33259260 ACTATCTTCTTCATGAAAGATGG - Intronic
1179023021 21:37656830-37656852 AGTCTCTTCCAGCAGAGAGAAGG - Intronic
1179334911 21:40441646-40441668 AGTATCTTTTAGACAAGAGAAGG - Intronic
1182662919 22:31937566-31937588 ATTATCTACAAGAAGACAGAAGG + Intronic
1185242771 22:49755377-49755399 AGAAGCTTCTAGAAGGAGGAGGG - Intergenic
1185310267 22:50150421-50150443 AGAAGCTTCCAGAAGATAGACGG + Intronic
949143247 3:662374-662396 ACTATCTGCAAGAAGGAAGAAGG - Intergenic
950296336 3:11835160-11835182 AGTATCTTGGACAAGAAAGTTGG - Intronic
951148124 3:19253866-19253888 ATTATGTTCTACAAGAAAAACGG + Exonic
955608912 3:60736812-60736834 AATATCTTATAGAAAAAAAATGG + Intronic
956358610 3:68420898-68420920 AGTTTCTTCTTTAAGAGAGAGGG - Intronic
956937324 3:74117957-74117979 AGTATCTGCTACAGGAAAAAAGG + Intergenic
957436526 3:80184278-80184300 TGTAGGTTCTTGAAGAAAGAAGG + Intergenic
958579708 3:96002107-96002129 AGAATCTTCTAACAGAAAGAAGG + Intergenic
961088109 3:124087448-124087470 TTTGTCTTCTAGATGAAAGAAGG + Intronic
961096079 3:124158037-124158059 AGTCTATCCTAGGAGAAAGATGG - Intronic
961154502 3:124667385-124667407 AATCTCTTCTATCAGAAAGATGG - Intronic
962654499 3:137529583-137529605 AGTAGCATCTAAAAGAAATATGG - Intergenic
963098797 3:141577535-141577557 AGGCTCTTCTCTAAGAAAGAAGG + Intronic
963118677 3:141756980-141757002 AAAATATTCTAGAAGAGAGATGG - Intergenic
963544731 3:146642190-146642212 TGTATCTACTTGAAGAAACAGGG - Intergenic
965179606 3:165384729-165384751 ATTAACAGCTAGAAGAAAGAAGG - Intergenic
967065478 3:185911518-185911540 AAAATCTTCAAGAACAAAGACGG - Intergenic
967287439 3:187886975-187886997 AATCTCTTCTAGAAGATAAAAGG - Intergenic
967384667 3:188899632-188899654 AGTAAATTCTCTAAGAAAGAGGG - Intergenic
970337270 4:15061393-15061415 AATATATTCTAGAAGCCAGATGG + Intronic
971245403 4:24922675-24922697 AGTATCTCCTTGAACTAAGAAGG - Intronic
973031900 4:45354382-45354404 TATGTCTTCTAGCAGAAAGAAGG + Intergenic
973700024 4:53527843-53527865 AGTATCTTCTCCAACAAATAAGG + Intronic
973898249 4:55438533-55438555 AAAATCTGTTAGAAGAAAGAAGG + Exonic
975517874 4:75267079-75267101 AGTAGCCTCTAGAAGAATGTGGG + Intergenic
975891245 4:79030697-79030719 AGTATCTTCTAGAAAGAAAAGGG - Intergenic
976261880 4:83153330-83153352 AGGATCTTCTGTAAGAAAAAAGG + Intergenic
977125023 4:93154637-93154659 AGTATCTGATTGAAGAAACAAGG + Intronic
978960745 4:114675217-114675239 ATTAGATTCTAAAAGAAAGATGG - Intronic
979898030 4:126185752-126185774 AGAATCTTTTAGGAAAAAGAGGG - Intergenic
980221665 4:129925130-129925152 AGTATCTTCAAGAACAAAATCGG - Intergenic
980577134 4:134698322-134698344 TGTATCTGTTGGAAGAAAGAAGG + Intergenic
980748204 4:137050023-137050045 AGTATTTTTTAAAAGAAAAAAGG - Intergenic
983367778 4:166816800-166816822 AAAATCTCCTAGAAGACAGAAGG + Intronic
984245448 4:177269737-177269759 AGTATATTTAAGAATAAAGATGG + Intergenic
984442024 4:179783649-179783671 AGTTTCCTCCAGAAGATAGAAGG - Intergenic
986167394 5:5286997-5287019 GGTATCTTGAAGAAGAATGAAGG + Intronic
988035132 5:25817960-25817982 TATATGTTCAAGAAGAAAGATGG - Intergenic
988144369 5:27286394-27286416 ATTATTTTCTAGAATAAACATGG - Intergenic
990118346 5:52417301-52417323 AGCATATTCTGGAAGAAAGAAGG + Intergenic
990530559 5:56669530-56669552 AATATCCTCTAGCAGAAAAAAGG + Intergenic
991430656 5:66541512-66541534 AGAATCTGCTGGAAGAAAGGAGG - Intergenic
991908219 5:71534189-71534211 ATCATCTTTTAGAAGAAAAATGG - Intronic
992008843 5:72507447-72507469 AGTACCTTCGGGAAGAAGGAAGG + Exonic
992223651 5:74597398-74597420 AGTTACTTCTAGCAGAGAGAAGG - Intergenic
992646421 5:78815915-78815937 AGTGCCTTCTCCAAGAAAGAAGG - Intronic
992902811 5:81315944-81315966 ATTATATTCTAGCAGAGAGATGG - Intergenic
993218321 5:85055610-85055632 AGTATTTTCTAGACAAAATATGG - Intergenic
995197350 5:109386485-109386507 AGTATCTTTAAGAAGAAAAGTGG - Intronic
995336736 5:111008253-111008275 AGAATTTCCTAGAAGAAGGAAGG - Intergenic
995378848 5:111510255-111510277 AATATATTCTAGAACCAAGAGGG + Intronic
996302961 5:122009878-122009900 ACTAGCTTCTAAAAGAAAAATGG - Intronic
996589013 5:125124602-125124624 TGTACCGTCTAGATGAAAGACGG - Intergenic
996924123 5:128802789-128802811 AGTATCTATTAGGAAAAAGAAGG + Intronic
997290131 5:132725537-132725559 AGTATCATCTAGGATTAAGAAGG - Intronic
999918506 5:156290390-156290412 AGTATCTTTTTCAAGAAATAAGG + Intronic
1000671840 5:164072835-164072857 AATTTTTTCTAGAAGATAGAAGG - Intergenic
1001257979 5:170199722-170199744 GATATCTTCTAGAGAAAAGATGG - Intergenic
1005017073 6:21384601-21384623 TGTATGTTCGAGAAGAAAGGGGG - Intergenic
1005346829 6:24898748-24898770 AGTTCCTGCTAGCAGAAAGATGG - Intronic
1005426624 6:25709753-25709775 AGTATTTTATTGAAAAAAGATGG + Intergenic
1008827995 6:55722193-55722215 AGTATTTTCCAGAAGAAATAGGG - Intergenic
1009758935 6:67978659-67978681 TGTATCTTCTACCAAAAAGAAGG - Intergenic
1010329010 6:74599848-74599870 AGTAAGTTATAGAAGAAATAGGG - Intergenic
1010453043 6:76024909-76024931 TGTATATAATAGAAGAAAGAAGG + Intronic
1010702626 6:79068855-79068877 ATTATATACTAGAGGAAAGAAGG - Intronic
1012703805 6:102496197-102496219 AATATCTTTTAGAAGAAATGAGG + Intergenic
1013828014 6:114238601-114238623 AATATGTAATAGAAGAAAGAAGG + Intronic
1015323342 6:131900550-131900572 AGCATATTCAAGAAGAGAGATGG - Intergenic
1015825855 6:137311096-137311118 AGAATCTTCTAGAAGAGAAGAGG + Intergenic
1017282830 6:152641831-152641853 TGTATCTTTTAGTAGAAACAGGG + Intergenic
1017542363 6:155415898-155415920 AGTATATTATAGAGCAAAGAGGG + Intronic
1017556311 6:155574618-155574640 AGATTAATCTAGAAGAAAGAGGG - Intergenic
1017670560 6:156765841-156765863 GGGTTTTTCTAGAAGAAAGAAGG + Intergenic
1017963791 6:159246376-159246398 AGAATATTCCAGAAGCAAGATGG + Intronic
1018058085 6:160069499-160069521 GGTAGCTTCTTGAATAAAGAAGG + Intronic
1018219922 6:161567522-161567544 AGTATCAGCTGAAAGAAAGAAGG + Intronic
1018466972 6:164056976-164056998 AGTATCCTCTAGAATAAAACAGG + Intergenic
1018469889 6:164085882-164085904 TGTGTCTTCATGAAGAAAGATGG - Intergenic
1018496098 6:164347255-164347277 AGAATCATCTAGAAGAAGGTTGG - Intergenic
1020577976 7:9958055-9958077 AGTATCTTTTAAAACAAAAACGG - Intergenic
1023124126 7:36938062-36938084 AGTATATTTTAGAAAAAGGATGG - Intronic
1023196619 7:37647323-37647345 AGTGTCTTCAAGAAGACACAGGG - Intergenic
1024556687 7:50609699-50609721 AGAGACTTCTAGAAGACAGAGGG + Intronic
1027135313 7:75619886-75619908 GGTATCTTTTAGAAGAAAATAGG - Intronic
1027870731 7:83704057-83704079 AGTACTTTATAAAAGAAAGATGG - Intergenic
1029043421 7:97601341-97601363 AGTATCTGCTTACAGAAAGATGG + Intergenic
1032656122 7:133931919-133931941 AGCCTCTTCTAGAAGAAGCAAGG - Intronic
1033420656 7:141201910-141201932 AGTCTCTTCTGAAAGAAAGCAGG - Intronic
1035348292 7:158223274-158223296 AATATCTTCCAGAAAATAGAAGG + Intronic
1035968141 8:4217533-4217555 AGTGTCTTCTTGAATAAGGAAGG + Intronic
1036039726 8:5062345-5062367 AGTATATTTTAAATGAAAGAAGG + Intergenic
1036596485 8:10217456-10217478 AAAATCTTCTAGAAGACAGCTGG - Intronic
1037279768 8:17226000-17226022 AGTTTCTTCTAGTAGAGAGGTGG + Intergenic
1037399160 8:18476295-18476317 AGTATCTTTTAAAAGAAATTGGG + Intergenic
1038121414 8:24620479-24620501 ACTATCTTCTTGTAGAAATAAGG - Intergenic
1039829632 8:41202514-41202536 AGAACCTTCTAGAGCAAAGAAGG - Intergenic
1040769646 8:50957377-50957399 AATATGTTCAAGAAGAAATATGG - Intergenic
1042826552 8:72985653-72985675 AGTAACATTTAAAAGAAAGATGG - Intergenic
1043325537 8:79046115-79046137 AGTATGTTGTTGAATAAAGATGG - Intergenic
1043809790 8:84723618-84723640 AGTTACTCATAGAAGAAAGATGG - Intronic
1044839514 8:96325976-96325998 AGAAACTTCAAGAAGGAAGAAGG + Intronic
1045018143 8:98017120-98017142 AGTATACTCTAGTGGAAAGATGG + Intronic
1045435802 8:102162532-102162554 AGTATCTTCCAGAAGTAGGAGGG + Intergenic
1045495878 8:102708108-102708130 AGTGTCTTACAGATGAAAGATGG + Intergenic
1045807432 8:106180840-106180862 GATATCTTTTAGAAGAAAGTAGG + Intergenic
1046054640 8:109064565-109064587 TGTATCTTTTTGAAGAATGAAGG - Intergenic
1048131399 8:131701710-131701732 ACTTTCTTCAAGAAGAAACAGGG - Intergenic
1048580729 8:135728256-135728278 ACTATCATCTGGAAGAGAGAGGG - Intergenic
1050303716 9:4285597-4285619 AGTATAGTGTAGAAGAAAGGTGG - Intronic
1051164874 9:14250889-14250911 AGAGTATTCTAGAAGAAAGGAGG - Intronic
1051646763 9:19276143-19276165 TGTATTTTCTAGAAGAGGGAGGG - Exonic
1052257388 9:26474346-26474368 AATATATTCTAGGAGAGAGAAGG - Intergenic
1052495498 9:29218514-29218536 GGTATTTGCTAGAAGGAAGAGGG + Intergenic
1053596241 9:39564537-39564559 AGAATCATCTTGAAGAAGGAAGG + Intergenic
1053710678 9:40804691-40804713 AGCATCTTCAACAAGAAAAATGG - Intergenic
1054420589 9:64925469-64925491 AGCATCTTCAACAAGAAAAATGG - Intergenic
1054570014 9:66800480-66800502 AGAATCATCTTGAAGAAGGAAGG - Intergenic
1054975491 9:71139041-71139063 AGTAACCTCTAGAGGAGAGAAGG - Intronic
1054990914 9:71325699-71325721 AGGATCGTTGAGAAGAAAGAAGG - Intronic
1055007718 9:71527595-71527617 AGGATCTTCTAGAATGAGGATGG - Intergenic
1057717066 9:97503113-97503135 AGTCACCTCTGGAAGAAAGATGG - Intronic
1057768241 9:97942590-97942612 AGTTTGTTCTAGTAGGAAGAGGG - Intronic
1060130653 9:121094551-121094573 ACTATCTTTTGGAAGAAAGGAGG + Intronic
1060160705 9:121360595-121360617 TGTATCTTCATGAAGAAAAATGG + Intronic
1188060383 X:25594007-25594029 AGTATTTTCTTTGAGAAAGATGG + Intergenic
1188611461 X:32103910-32103932 AGTGTCATTTAGCAGAAAGAAGG + Intronic
1188817390 X:34731863-34731885 AATATTTCCTAGGAGAAAGAAGG + Intergenic
1193343855 X:80383406-80383428 CTTCTTTTCTAGAAGAAAGAAGG - Intronic
1193429817 X:81388016-81388038 AATCTCTTCCAGAAGATAGAAGG - Intergenic
1193846050 X:86472225-86472247 AGATCCTTATAGAAGAAAGAGGG + Intronic
1196089934 X:111729253-111729275 AGTATCTTTTAAAAGTAACAAGG - Intronic
1198531892 X:137556004-137556026 ACCTCCTTCTAGAAGAAAGAAGG - Intergenic
1198875591 X:141222557-141222579 AGTATTTACTAGAGGATAGATGG - Intergenic
1198934357 X:141890376-141890398 TGTATTTTTTAGAAGAAACAGGG + Intronic
1199062379 X:143374416-143374438 AGTATGTTCAAGCTGAAAGATGG - Intergenic