ID: 906972149

View in Genome Browser
Species Human (GRCh38)
Location 1:50526792-50526814
Sequence GAACCCTCATTGGCTGCTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 631
Summary {0: 1, 1: 0, 2: 3, 3: 73, 4: 554}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906972149 Original CRISPR GAACCCTCATTGGCTGCTAG TGG (reversed) Intronic
900640647 1:3686604-3686626 GAACCCTCAGTGGGCTCTAGAGG + Intronic
900912782 1:5613693-5613715 CAATCCTCATAGGCTGCTGGTGG - Intergenic
900958038 1:5900091-5900113 GAATCCTCATTCACTGCTGGTGG + Intronic
900965246 1:5952884-5952906 GGACCCTCGGTGGCTGCCAGTGG - Intronic
901406583 1:9051655-9051677 GAACCCTCATTTGTTGCTGGTGG + Intronic
902121690 1:14171401-14171423 GAACCCTCATAGGTTGCTGGTGG - Intergenic
902424827 1:16311743-16311765 GAACTCTCATTCACTGCTAGTGG + Intronic
902647502 1:17811093-17811115 GAACTCTCATACACTGCTAGTGG - Intronic
903463743 1:23537641-23537663 GAACCCTCATTCATTGCTGGTGG + Intergenic
903468882 1:23571198-23571220 GAACCCTCATATGCTGCTGATGG + Intergenic
904357234 1:29948279-29948301 CACCCCTCATGGGCTGCTGGAGG - Intergenic
904771564 1:32884163-32884185 GAACCTTCTTTGGCTGTTGGGGG + Intergenic
905050784 1:35049173-35049195 GAACTCTCATACACTGCTAGAGG - Intergenic
906181918 1:43828787-43828809 GAACGCTCATTCACTGCTGGTGG + Intronic
906195399 1:43927465-43927487 TAACCCTCAATGACTCCTAGTGG + Intronic
906553993 1:46692578-46692600 GAACTCTCATTCCCTGCTGGTGG - Intronic
906661054 1:47582300-47582322 GAACCCTCATACACTGCTGGTGG - Intergenic
906972149 1:50526792-50526814 GAACCCTCATTGGCTGCTAGTGG - Intronic
908546054 1:65163217-65163239 GAACCTTCATTCATTGCTAGTGG - Intronic
908700945 1:66899214-66899236 GAACCCTCATACACTGCTTGTGG - Intronic
909561274 1:77011388-77011410 GAGTGCTCATTTGCTGCTAGGGG + Intronic
910494602 1:87812524-87812546 GGACCCTCATTCTCTGCTACTGG - Intergenic
910502716 1:87911230-87911252 AAACCCTCATTTGCTACTAGTGG - Intergenic
910817182 1:91303621-91303643 GAACCCTCATACACTGCTAGTGG - Intronic
911073698 1:93852398-93852420 GAACCCTCATTCATTGCCAGTGG + Intergenic
911172928 1:94789209-94789231 GAACCCTCATACACTGCTGGTGG + Intergenic
911470352 1:98310511-98310533 GAACCCTCATAGACTGTTAGTGG + Intergenic
912756334 1:112327743-112327765 GAACTCTCATTCATTGCTAGTGG - Intergenic
913035464 1:114960519-114960541 GAACCCTCATACACTGCTGGTGG - Intronic
913266845 1:117053654-117053676 GAACCCTCATACGTTGCTGGTGG + Intergenic
916546102 1:165805983-165806005 GAACCCTCCTTCACTGTTAGTGG + Intronic
916592804 1:166209386-166209408 GAACCCTCATACACTGCTAGTGG - Intergenic
916898802 1:169198232-169198254 GAACCCTCAAATACTGCTAGTGG + Intronic
916938024 1:169650768-169650790 GAACTTTCATTCACTGCTAGCGG + Intergenic
917278735 1:173358444-173358466 GAACCCTCATAGACTGCTGCTGG + Intergenic
917585188 1:176418866-176418888 GAACTCTCATTTACTGCTAGTGG - Intergenic
917746108 1:178009360-178009382 AAACTCCCATTTGCTGCTAGAGG + Intergenic
917912507 1:179664909-179664931 GAACCCTCATACACTGCTGGGGG - Intronic
919280174 1:195480904-195480926 TAACCCTCATTTTCTGCTGGTGG + Intergenic
919716949 1:200788493-200788515 GAACTTTCATTCACTGCTAGTGG - Intronic
920688485 1:208128015-208128037 GAACCCACACTGGCTGATGGAGG + Intronic
920974331 1:210771452-210771474 GATCCCTCCTTTGCTGCAAGAGG + Intronic
921422584 1:214965466-214965488 GAACTCTCATTCATTGCTAGTGG - Intergenic
921914718 1:220594401-220594423 GAACTCTCATTTGTTGCTGGCGG + Intronic
922288326 1:224188470-224188492 GAACCCTCATACTTTGCTAGTGG - Intronic
922325289 1:224522788-224522810 GAACCCTCATCCTCTGCTGGTGG + Intronic
922567287 1:226608914-226608936 GAACCCTGCTTGGCCCCTAGAGG - Exonic
922643144 1:227256679-227256701 GAACCCTCATTCATTGCTAGAGG + Intronic
922948084 1:229534301-229534323 GAACTCTCATTCCTTGCTAGTGG + Intronic
923061861 1:230482933-230482955 GAACTCCCATTCGCTGCTAGTGG + Intergenic
923319661 1:232818294-232818316 GAACTCTCACATGCTGCTAGTGG - Intergenic
923361955 1:233220396-233220418 GAACGCTCATTCACTGCTGGTGG - Intronic
924126478 1:240858351-240858373 GAACTCTCATTCTCTGCTGGTGG - Intronic
924286058 1:242488098-242488120 GAACTCTCATTAATTGCTAGTGG + Intronic
924333062 1:242959600-242959622 GAACCCTCATATGTTGCTAGTGG - Intergenic
924559453 1:245145642-245145664 GAACCCTCATGCGTTGCTGGTGG - Intergenic
924635193 1:245780053-245780075 GAACCCTCATACCCTGCTGGTGG + Intronic
1062761362 10:23617-23639 GAACCCTCATTTACTGTTGGTGG + Intergenic
1063379218 10:5573971-5573993 GAACCCAGTTTGGCTGCTAGAGG - Intergenic
1063895086 10:10671546-10671568 GAACTCTCATTCGCTGCTTGTGG - Intergenic
1064023290 10:11826487-11826509 GAACCCTCACACGTTGCTAGTGG - Intronic
1064448750 10:15422245-15422267 AAACCCTCATACGCTGCTGGTGG + Intergenic
1065177557 10:23094734-23094756 GAACTCGCATAGACTGCTAGTGG + Intergenic
1065196547 10:23271533-23271555 GAACTCTTATTCTCTGCTAGTGG - Intronic
1065336642 10:24659065-24659087 GAACCCTCATTCATTGCTGGTGG + Intronic
1065462934 10:25988460-25988482 GAACTCTCATACACTGCTAGAGG + Intronic
1066089748 10:32005743-32005765 AAACTCTCAGTGGCTGCTTGAGG - Intergenic
1066485523 10:35839272-35839294 GAACCCTCATTCACTGTTGGTGG - Intergenic
1066498708 10:35969550-35969572 GAACTCTCATTCACTGCTGGTGG + Intergenic
1067076375 10:43187506-43187528 GAACTCTCATTCACTGCTGGTGG - Intergenic
1067216105 10:44305157-44305179 GAACCCTCATGTGCTGTTGGTGG + Intergenic
1067290897 10:44939225-44939247 GAACCCTCATACACTGCTGGTGG - Intergenic
1067306361 10:45068198-45068220 GAACCCTCATACACTGCTGGTGG - Intergenic
1067340522 10:45398841-45398863 GAACCCTCATACACTGCTGGTGG + Intronic
1067380853 10:45771778-45771800 GAACCCTCATACACTGCTGGTGG + Intronic
1067383607 10:45797905-45797927 GAACTCTCATTCACTGCTGGTGG + Intergenic
1067384401 10:45805529-45805551 GAACCCTCATATGCTGCTGGTGG - Intergenic
1067678623 10:48410742-48410764 GAACCCGCATACACTGCTAGTGG - Intronic
1067879792 10:50033292-50033314 GAACCCTTATATGCTGCTGGTGG + Intergenic
1067880574 10:50040895-50040917 GAACTCTCATTCACTGCCAGTGG - Intergenic
1067888552 10:50112429-50112451 GAACCCTCATACACTGCTGGTGG + Intronic
1067891308 10:50138474-50138496 GAACTCTCATTCACTGCCAGTGG + Intergenic
1068397402 10:56481690-56481712 AAACCCTCATACACTGCTAGTGG + Intergenic
1068397407 10:56481769-56481791 AAACCCTCATCTTCTGCTAGTGG + Intergenic
1069668957 10:70185553-70185575 GAACCCTCATACACTGCTGGTGG - Intergenic
1070245206 10:74724588-74724610 GAACCCTCATTCATTGCTGGTGG + Intergenic
1070720046 10:78750172-78750194 GAACCCTCATGCACTGCTTGTGG + Intergenic
1071086556 10:81874267-81874289 AAACCAGCATTAGCTGCTAGTGG + Intergenic
1071214377 10:83382731-83382753 GAACCCTCATTTATTGCTTGTGG + Intergenic
1071344320 10:84677503-84677525 GAACTCTCATATGCTGCTGGTGG - Intergenic
1071506625 10:86236007-86236029 GAACCCTCATACACTGCCAGCGG - Intronic
1072193972 10:93099070-93099092 GAACCCTCTTGCACTGCTAGTGG - Intergenic
1072338413 10:94421646-94421668 GAACCCTCATTCATTGCTAGTGG - Intronic
1073129864 10:101181070-101181092 GAACTCTCATTCATTGCTAGTGG - Intergenic
1073308354 10:102521083-102521105 GAACTCTCATTCATTGCTAGTGG - Intronic
1074765668 10:116698465-116698487 GAACCCTCACACGCTGCTGGTGG - Intronic
1074804624 10:117036165-117036187 GAACCCTCATACACTGCTGGGGG + Intronic
1074947190 10:118291974-118291996 GAACCCTCATATATTGCTAGTGG - Intergenic
1075437105 10:122452964-122452986 GAATCCTCATGCACTGCTAGTGG - Intergenic
1077851993 11:6081960-6081982 GAGCCCTCATAGACTGTTAGTGG + Intergenic
1077924344 11:6665901-6665923 GAACCCTCATTTACTGGTGGTGG - Intergenic
1078075168 11:8152126-8152148 GAACTCTCATACGCTGCTAGTGG + Intronic
1078126522 11:8570300-8570322 GAACCCTCATTTGTTGATGGCGG + Intronic
1078181157 11:9012291-9012313 GAACCCTCATACACTGCTGGTGG - Intergenic
1078977253 11:16492994-16493016 GAACTCTCATACTCTGCTAGTGG + Intronic
1080124872 11:28721095-28721117 CAACCATCAGTGGCTGCTGGAGG - Intergenic
1080294319 11:30708124-30708146 GAACCCTCATACACTGTTAGTGG + Intergenic
1080305964 11:30836593-30836615 GAACCCTCATTTATTGCTGGTGG + Intronic
1080879367 11:36304905-36304927 GAATCCTCATGTGCTGCTGGTGG + Intronic
1081129550 11:39361712-39361734 GAACCCTCATTCATTGCTGGTGG - Intergenic
1081479232 11:43469249-43469271 GAACCCTCATATGTTGCTAGTGG + Intronic
1081943023 11:46961179-46961201 GAACCCTCATATACTGCTGGTGG - Intronic
1084152173 11:67293261-67293283 GAACCCTCACATGCTGCTGGTGG - Intronic
1084901757 11:72315118-72315140 GATCCTTCATTGGCTGTAAGGGG + Intronic
1085138090 11:74112827-74112849 GAACCTTCATATACTGCTAGTGG + Intronic
1085268419 11:75252246-75252268 GAACTCTCATACACTGCTAGTGG - Intergenic
1085550555 11:77366727-77366749 GAACCCTCATTAATTGCTAGTGG + Intronic
1087257277 11:95970089-95970111 GAACTCTCATACACTGCTAGTGG - Intergenic
1087421567 11:97932992-97933014 GAACACTCATTTGCTGCTGGTGG + Intergenic
1088150187 11:106735744-106735766 GAACCCTCATATGCTGTTGGTGG - Intronic
1088539526 11:110899023-110899045 GAACTCTCATTCGTTACTAGTGG - Intergenic
1089239108 11:117059881-117059903 GAACTCTCATTTACTGCTGGTGG + Intronic
1089476946 11:118771823-118771845 GAACTCTCATACACTGCTAGTGG + Intronic
1090777749 11:129980074-129980096 GAGCCCTCACAGGCTGCTGGTGG + Intronic
1092805527 12:12218894-12218916 AAACCCTCATACACTGCTAGTGG + Intronic
1093099370 12:15009313-15009335 GAACTTTCAGTGGCTGCTAAAGG - Intergenic
1093797720 12:23333299-23333321 GAACCCTCATATGCTGTTTGTGG - Intergenic
1095879718 12:47120213-47120235 GAATCCTCCTGTGCTGCTAGTGG + Intronic
1096025147 12:48353998-48354020 GAACCCTCATACACTGCTAGTGG - Intergenic
1096218652 12:49813260-49813282 GAACCCTCATACACTGCTGGTGG - Intronic
1096998156 12:55853212-55853234 GAACTCTCATTCATTGCTAGTGG + Intergenic
1097607610 12:61775184-61775206 GAACTCTCATTCATTGCTAGTGG + Intronic
1097648868 12:62269992-62270014 GAACCCTCATACACTGCTGGTGG - Intronic
1097714227 12:62948601-62948623 GAACCCTCATACACTGTTAGTGG - Intergenic
1097919853 12:65060084-65060106 GAACCCTCATACACTGCTGGTGG + Intronic
1099221518 12:79920469-79920491 GAACCCTCATGCACTGCTGGTGG - Intronic
1099870614 12:88344646-88344668 GAACTCTCATTCGTTGCTGGTGG - Intergenic
1100322667 12:93510557-93510579 GAACCCTTATTCACTGCTGGTGG - Exonic
1100441793 12:94624161-94624183 GAACCCTCATACACTGGTAGTGG + Intronic
1101025697 12:100603253-100603275 GAACCCTCATACACTGCTGGTGG - Intronic
1101053779 12:100891433-100891455 GAACCTTCATTCACTGCTGGTGG - Intronic
1101057160 12:100929724-100929746 GAACCCTCATACACTGCTGGTGG - Intronic
1101815857 12:108145521-108145543 GGACCCTCATGCGCTGCTGGTGG + Intronic
1101844667 12:108353119-108353141 GAACCCTCATACTCTACTAGAGG + Intergenic
1102399908 12:112619652-112619674 GAACCCTCATACACTGCTGGTGG - Intronic
1103570376 12:121840662-121840684 GAACCCTCATGTACTGCTGGTGG + Intronic
1104278158 12:127349873-127349895 GAACTCTCATTTATTGCTAGTGG + Intergenic
1105518255 13:21109693-21109715 GAACTCTCATTCACTGCTGGTGG + Intergenic
1106126649 13:26905214-26905236 GAACCCTCATTTACAGCTGGTGG - Intergenic
1106198870 13:27519722-27519744 GAACCCTCATACATTGCTAGTGG + Intergenic
1106284201 13:28305139-28305161 GAACCCTCATACACTGCTGGTGG - Intronic
1106710215 13:32323030-32323052 GAACTCTCATTCACTGCTGGTGG - Intronic
1107067286 13:36228273-36228295 GAACCCTCATATGTTGCTGGTGG - Intronic
1108211780 13:48146787-48146809 GAACTCTCATTCACTGCTGGTGG - Intergenic
1108297022 13:49032167-49032189 GAACCCTCATACACTGCTGGTGG + Intronic
1108878714 13:55082154-55082176 GAACCCTCATCCACTGCTGGTGG - Intergenic
1110921167 13:81087749-81087771 GAACCCTCATATGCTGTTGGTGG + Intergenic
1111075090 13:83224205-83224227 GAACTCTCCTTTGCTGCTGGTGG - Intergenic
1112165366 13:96912939-96912961 GAACCCTCATTCACTGTTGGTGG - Intergenic
1112241050 13:97681396-97681418 GAACCCTCATTCACTGCAGGTGG - Intergenic
1112405152 13:99113101-99113123 GAACCCTCATATGTTGCTGGTGG - Intergenic
1112522999 13:100114803-100114825 GAACCCTCATATGCTGTTGGTGG + Intronic
1112606019 13:100907228-100907250 GAACCCTCATTTGTTGATGGTGG + Intergenic
1112964153 13:105166133-105166155 GATCTCTCATATGCTGCTAGAGG + Intergenic
1113732922 13:112655328-112655350 GAACTCTCCTTGGCTGCTGGGGG + Intronic
1114705244 14:24719400-24719422 GAACCCTCATATGCTGCTGGTGG + Intergenic
1115189173 14:30728679-30728701 GAACCCTCATGCACTGCTGGGGG - Intronic
1116723428 14:48529806-48529828 GAACTCTCATTCGTTGCTGGTGG - Intergenic
1117542992 14:56766852-56766874 GAACCCTCATGCACTGCTGGTGG + Intergenic
1118035623 14:61863233-61863255 GAACTCTCATTCACTGCTGGTGG - Intergenic
1118754582 14:68830846-68830868 GAACCCTCATAGACTGTTGGTGG - Intergenic
1118928709 14:70219455-70219477 GAACACTCATATGCTGCTTGTGG - Intergenic
1119173367 14:72551340-72551362 GGTCCCTGATTGGCTGCTCGTGG + Intronic
1120203412 14:81562760-81562782 GAATCCTGGTTGACTGCTAGTGG - Intergenic
1120332419 14:83110945-83110967 GAACCCTTATTTACTGCTGGTGG + Intergenic
1120832595 14:89011135-89011157 GAACACTCATACACTGCTAGAGG + Intergenic
1121257596 14:92542447-92542469 GAACCCTCATATGCTGCTGGTGG + Intronic
1121938923 14:98049093-98049115 GAACCACCTTTGGCTGCCAGGGG - Intergenic
1122553586 14:102563841-102563863 GAACTCTCATTCCCTGCTGGTGG - Intergenic
1122619014 14:103042812-103042834 GAACCCTTGTGGGCTGCTGGTGG + Intronic
1122912824 14:104841656-104841678 GGACCCTCATTTGCTGATGGCGG - Intergenic
1123962539 15:25420685-25420707 GAACCCTTATTCACTGCTGGTGG + Intronic
1124029423 15:25996201-25996223 GAACCCTCATACGCTGCTGGTGG - Intergenic
1124142656 15:27090498-27090520 GAACCCTCATAGGTTGTTGGTGG - Intronic
1124324256 15:28743717-28743739 GAACCCTCATTTACTGCTTCTGG - Intergenic
1124528139 15:30476754-30476776 GAACCCTCATTTACTGCTTTTGG - Intergenic
1124770518 15:32530950-32530972 GAACCCTCATTTACTGCTTTTGG + Intergenic
1125062640 15:35442404-35442426 GAACCCTCATTCATTGCTAGTGG + Intronic
1125453375 15:39832247-39832269 GAACCCTCATAGACTGCTGGTGG + Intronic
1125466309 15:39956518-39956540 GAACCCCAGTTGGCTGCCAGGGG + Intronic
1126805029 15:52339762-52339784 TAACCCTACTTGTCTGCTAGAGG + Intronic
1127176406 15:56363206-56363228 GAACCCTCATAAACTGTTAGTGG - Intronic
1127611036 15:60636756-60636778 GAACCCTCCCTGGATGGTAGTGG - Intronic
1127675698 15:61236356-61236378 GAAATCTCATTCACTGCTAGTGG - Intergenic
1127738438 15:61870744-61870766 GAACCCTCATACACTACTAGTGG - Intronic
1127822462 15:62670895-62670917 GAACCCTCATACACTGCTGGCGG - Intronic
1128393953 15:67204288-67204310 TCACCCTGCTTGGCTGCTAGTGG + Intronic
1128472345 15:67965459-67965481 GAACCCTCATATGTTGCTGGTGG - Intergenic
1128888358 15:71308851-71308873 GAACCCTCATACGTTGCTGGTGG - Intronic
1129545989 15:76395459-76395481 GAACCCTCATACGCTGTTGGTGG - Intronic
1129581964 15:76821005-76821027 GAACACTCATTTATTGCTAGTGG + Intronic
1129590308 15:76908959-76908981 GAACCCTTATATGCTGCTGGTGG - Intergenic
1129684722 15:77678776-77678798 GAACTCTCCTAGGTTGCTAGTGG - Intronic
1129805563 15:78454067-78454089 GAAACCTCATACACTGCTAGTGG + Intronic
1130318281 15:82815675-82815697 GAACCCTCATTTACTGCTTTTGG - Intronic
1130527230 15:84717609-84717631 GAACCCTCATATACTGCTGGTGG + Intergenic
1130840142 15:87691700-87691722 GAACCCTCATACGTTGCTGGTGG + Intergenic
1132050328 15:98602410-98602432 GAACCCTCATATGCTGCCGGCGG + Intergenic
1132133069 15:99303102-99303124 GAACCCTCATACACTGCTAGTGG - Intronic
1132596937 16:756477-756499 GAACTCTCAGAGGCTGCTGGTGG - Intronic
1133345745 16:5069310-5069332 GAACCCTCATCTTCTGCCAGTGG - Intronic
1134205486 16:12234150-12234172 GAACCTTCATTCACTGCTGGTGG - Intronic
1134782695 16:16912992-16913014 GAACTCTCATTTACTGCTGGTGG + Intergenic
1135242708 16:20822998-20823020 GAAACCTCATATGCTGCTGGTGG - Intronic
1135243831 16:20836734-20836756 GAACTCTCATTCACTGCTGGTGG - Intronic
1137966386 16:52937827-52937849 GAACTCTCATTCACTGCTGGTGG + Intergenic
1140142165 16:72268636-72268658 GAACCCTCATACACTGTTAGTGG - Intergenic
1141510234 16:84507133-84507155 GAACTCTCCTTGGCTCCCAGAGG + Intronic
1144365017 17:14535129-14535151 GAACCCTCATACATTGCTAGTGG - Intergenic
1144681297 17:17197043-17197065 GAACCCTCATTCACTGCTGGTGG + Intronic
1144935185 17:18892440-18892462 GAACCCTCATACTCTGCTGGTGG - Intronic
1145095902 17:20025821-20025843 GAAACCTCATTCGCTGCTGTTGG - Intronic
1146560896 17:33869290-33869312 GAACCCTCATACACTGCTGGTGG + Intronic
1147226413 17:38981581-38981603 GAACCCTCATTCATTGCTGGTGG + Intergenic
1147347096 17:39806616-39806638 GAACCCTCATCCGTTGCTGGTGG + Intronic
1147485731 17:40811739-40811761 GAACCCTCATATATTGCTAGTGG - Intergenic
1147931224 17:43982913-43982935 GCACCCCAATTGGCTGCTGGAGG - Intronic
1148023715 17:44570557-44570579 AAACCCTCATTCACTGCTGGTGG - Intergenic
1148691655 17:49530968-49530990 GAACTCTCATTCACTGCTGGTGG - Intergenic
1150537752 17:66061310-66061332 GAACCCTTATATACTGCTAGAGG + Intronic
1150769163 17:68026695-68026717 GAACTCTCATTCATTGCTAGTGG + Intergenic
1151220475 17:72608354-72608376 GAACCCTCATCCTCTGCTGGTGG + Intergenic
1152232748 17:79122585-79122607 GAACCCTCATACACTGCTGGCGG + Intronic
1152954269 18:23947-23969 GAACCCTCATTTACTGTTGGTGG + Intergenic
1152996909 18:416299-416321 GATCCCACACTGGCTGCTGGAGG + Intronic
1153004643 18:486847-486869 GAACCCTCATATGCTGTTGGTGG + Intronic
1153474711 18:5486856-5486878 GAATCCTCATAAACTGCTAGTGG + Intronic
1154180393 18:12133497-12133519 GAACCCTCATACACTGCTGGTGG - Intergenic
1155084408 18:22443124-22443146 GAACACTCATTTATTGCTAGTGG + Intergenic
1155665393 18:28301783-28301805 GAACTCTCATTCACTGCTAGTGG + Intergenic
1155764546 18:29611485-29611507 GAACTCTTATTCGTTGCTAGTGG + Intergenic
1156262141 18:35454901-35454923 GAACCCTCATCCATTGCTAGTGG + Intronic
1156268123 18:35506775-35506797 GAACTCTCGTTTGCTGCTGGTGG - Intergenic
1157164484 18:45345924-45345946 GAACTCTCATTTACTGTTAGTGG - Intronic
1157640641 18:49210087-49210109 GAACTCTCATTCACTGCTGGTGG + Intronic
1157715636 18:49885010-49885032 GAACCCTCATATGCTGCTGGTGG + Intronic
1157825903 18:50812119-50812141 GAACCCTCATACGTTGCTGGTGG - Intronic
1158078061 18:53554292-53554314 GAACTCTCATACACTGCTAGTGG - Intergenic
1159260258 18:66004594-66004616 GAACCCCCATGGGCTGGAAGTGG + Intergenic
1160536295 18:79596077-79596099 GAACGCTCATTCGCTGCTGGAGG + Intergenic
1161640145 19:5417451-5417473 GAACCCTCATTGGCTCCCTAGGG - Intergenic
1161940686 19:7401618-7401640 GAACCCTCATACACTGCTGGTGG + Intronic
1162537824 19:11274211-11274233 GGACCCTCATACGCTGCTGGTGG + Intergenic
1162703150 19:12534447-12534469 GAACCCTCATTTGTTACTTGTGG + Intronic
1163433485 19:17282087-17282109 GGACCCTAATTTGGTGCTAGAGG + Exonic
1163644667 19:18481966-18481988 GAACTCTCATTCGCTGCCGGCGG - Intronic
1164662620 19:29990274-29990296 GAACCCTCATTCATTGCTGGTGG + Intronic
1164699449 19:30273348-30273370 GAACTCTCATTCACTGCTAGGGG - Intronic
1164765490 19:30762794-30762816 GAACCCTCATTCACTGCTGGTGG - Intergenic
1164883194 19:31753660-31753682 GAACCCTTATTTGTTGCTGGTGG + Intergenic
1164926504 19:32134049-32134071 GAACCCTCATTCATTGCTGGTGG + Intergenic
1165181020 19:33969388-33969410 GAACCCTCATACACTGCTGGTGG - Intergenic
1165535622 19:36442085-36442107 GAACCCTCATATGCTGTTGGTGG - Intergenic
1166714725 19:44959779-44959801 GAACCCTCGTATGCTGCTAGGGG - Intronic
1168430669 19:56277072-56277094 GAACCCTCATATGCTGCTGGTGG + Intronic
925340845 2:3134661-3134683 GAACCCTCATATGCTACTGGTGG + Intergenic
926023269 2:9515816-9515838 GAACTCTCATTAATTGCTAGTGG - Intronic
926241445 2:11090286-11090308 GAACCCTCACTCATTGCTAGTGG + Intergenic
927470774 2:23374662-23374684 GAACCCACACAGGCTTCTAGAGG + Intergenic
927673202 2:25086375-25086397 GAACCCTCATTCATTGCTGGTGG - Intronic
927903033 2:26836206-26836228 AAACTCTCATTCACTGCTAGTGG + Intergenic
928338043 2:30415246-30415268 GAACCCTCATATACTGCTAGTGG - Intergenic
928587822 2:32779264-32779286 GAACCCTCATACATTGCTAGTGG - Intronic
928608415 2:32965942-32965964 GAACTCTCATTTGTTGCTGGTGG - Intronic
928803317 2:35120998-35121020 GAACCCTCATATGCTGTTTGTGG + Intergenic
929197015 2:39195415-39195437 GAGCCCTCATTCATTGCTAGTGG - Intronic
929421641 2:41796337-41796359 GAACTCTCATTTACTGCTGGTGG - Intergenic
929473830 2:42224661-42224683 AAACCCTCATATACTGCTAGTGG - Intronic
929623269 2:43379577-43379599 GAACTCTCATTCACTGCTGGTGG + Intronic
929845831 2:45525993-45526015 GAACCCTCATACACTGCTGGTGG + Intronic
929854192 2:45621936-45621958 CAACCCTGATTTCCTGCTAGAGG + Intergenic
929984272 2:46711268-46711290 GAACTCTCATAGATTGCTAGTGG - Intronic
931215415 2:60237760-60237782 GAACTCTCATAAGCTGCTGGTGG - Intergenic
931703819 2:64930243-64930265 GAACTCTCATACCCTGCTAGTGG - Intergenic
931726495 2:65116492-65116514 GAAGCCTAATTGGGTGGTAGTGG - Intronic
932233145 2:70099085-70099107 GAACCCTCATATACTGCTGGTGG - Intergenic
932889982 2:75585905-75585927 GAACACTCATAGACTGCTGGTGG + Intergenic
933200187 2:79438949-79438971 GAACCCTTATAGGTTGCTAGTGG + Intronic
933681372 2:85104457-85104479 GAACCCTCATATACTGCTGGTGG + Intergenic
933828650 2:86187985-86188007 GAACCCTCATACATTGCTAGTGG - Intronic
933848088 2:86341994-86342016 GAACTCTCATATGCTGCTGGTGG + Intergenic
934092028 2:88560061-88560083 GAACCCTCATACGTTGCTGGTGG - Intronic
934124613 2:88875534-88875556 GAACCCTCATTCACTGCTGATGG + Intergenic
934558570 2:95300443-95300465 GAAGCCACATTGGCTGCTCCTGG - Intronic
934741084 2:96723163-96723185 GAACCCTCATAGACTGCTGGTGG - Intronic
935741878 2:106156416-106156438 GAACACTCATATGCTGCTGGTGG + Intronic
936941969 2:117892793-117892815 GAACCCTCATTTATTGCTGGTGG - Intergenic
937141769 2:119608120-119608142 AAACCCTCATATGTTGCTAGTGG - Intronic
939109436 2:137989708-137989730 GAACTCTCATTCGCTGCTGGTGG - Intronic
940832377 2:158481502-158481524 GAACCCTCATACTCTGCTAGTGG - Intronic
941457740 2:165730271-165730293 GAACCCTCATATGTTGCTGGTGG + Intergenic
942137298 2:172939274-172939296 GAACTCTCATTCACTGCTAGTGG - Intronic
943194744 2:184731344-184731366 GAACTCTCATTTATTGCTAGTGG - Intronic
944268738 2:197758035-197758057 GAACCCTCATAATCTGCTGGTGG + Intronic
944270952 2:197785340-197785362 GCTCCCTGATTGGCTGCTGGCGG + Intronic
944824222 2:203465018-203465040 GAACTCTCATTCATTGCTAGTGG + Intronic
945203019 2:207303720-207303742 GAACCCTCATATACTGCTGGTGG + Intergenic
945838806 2:214864346-214864368 GAACCCTCATTCACTGTTGGTGG + Intergenic
946582888 2:221149886-221149908 GAACACTCATTGGAAGCTAAAGG + Intergenic
948279608 2:236736769-236736791 GAACCCTCATACACTGCTGGAGG + Intergenic
948557407 2:238822746-238822768 AAAGACTCATTGGCTGCAAGTGG + Intergenic
948587869 2:239031090-239031112 GAACCCTCGTTCACTGCTGGTGG - Intergenic
948914101 2:241021884-241021906 GAACCCTCATACATTGCTAGTGG - Intronic
1169102322 20:2961243-2961265 GAACTCTCATTCACTGCTGGTGG - Intronic
1169423699 20:5480032-5480054 AAACCCTCATACACTGCTAGTGG + Intergenic
1169547799 20:6668490-6668512 GAACCCTCATTCATTGCTGGTGG + Intergenic
1170059970 20:12248557-12248579 GAACCCTCATTCATTGCTGGTGG + Intergenic
1170867576 20:20173390-20173412 GAACTCTCATTCACTGCTGGTGG - Intronic
1171326571 20:24299165-24299187 GAGCCTTCATAGGCTGCCAGTGG - Intergenic
1171378334 20:24711266-24711288 GAACCCTCATTTATTGCTAGTGG - Intergenic
1172092488 20:32443851-32443873 GACCTCTTATTGGCTGCTGGTGG - Exonic
1172580560 20:36044130-36044152 TAACCCTCAGTGGCCGCAAGAGG - Intergenic
1172616457 20:36289255-36289277 GAACTCTCATTCACTGCTGGTGG - Intergenic
1172785681 20:37466825-37466847 GAACTCTCATAGGTTGCTGGTGG + Intergenic
1172812953 20:37663228-37663250 GATCCCTCATTCACTGCTGGTGG - Intergenic
1172849148 20:37948044-37948066 GAACCCTCATGCACTGCTGGTGG + Intergenic
1174873323 20:54203526-54203548 GAACCCTCATACGCTGTTGGTGG - Intergenic
1175339376 20:58218485-58218507 GACCCCTCATTAGCTCCTGGTGG - Exonic
1175360824 20:58411142-58411164 GAACTCTCATTCACTGCTGGTGG - Intronic
1175436546 20:58955468-58955490 GAACTTTCATTTGCTGCTGGCGG + Intergenic
1175659423 20:60799304-60799326 GAACTCTCATTTGCTGCTGATGG + Intergenic
1176345490 21:5741351-5741373 GAACCCTCATATGCTGTTGGTGG - Intergenic
1176352304 21:5861935-5861957 GAACCCTCATATGCTGTTGGTGG - Intergenic
1176499337 21:7583104-7583126 GAACCCTCATATGCTGTTGGTGG + Intergenic
1176539811 21:8139421-8139443 GAACCCTCATATGCTGTTGGTGG - Intergenic
1176558762 21:8322466-8322488 GAACCCTCATATGCTGTTGGTGG - Intergenic
1176982084 21:15394166-15394188 GAACTCTCGTTGGCTGCTGGTGG + Intergenic
1177105663 21:16952423-16952445 GAACCCTCATACACTGTTAGTGG + Intergenic
1177525476 21:22285186-22285208 GAACTCTCACACGCTGCTAGTGG - Intergenic
1178031427 21:28530811-28530833 GAACCCTCATTTATTGCTTGTGG - Intergenic
1178211840 21:30543523-30543545 GAATCCTCATTCGCTATTAGTGG - Intronic
1178394629 21:32231566-32231588 GAACGCTCATATGCTGCTGGTGG + Intergenic
1179018190 21:37613317-37613339 GAACCCTCATTCATCGCTAGTGG + Exonic
1179653167 21:42828034-42828056 GAACCCTCATAGACTGGTGGTGG - Intergenic
1180566239 22:16668032-16668054 GAACCCTCATACACTGCCAGTGG + Intergenic
1181470027 22:23132669-23132691 GAACTCTCATATACTGCTAGTGG + Intronic
1183338063 22:37262278-37262300 GGACCCTCACTGAATGCTAGGGG + Intergenic
1183611456 22:38909620-38909642 GAACCCTCATACATTGCTAGTGG - Intergenic
1183933043 22:41246949-41246971 GAATCCTTACTGGCTGCCAGTGG + Intronic
1185167112 22:49268236-49268258 CCAGCCTCATTGGCTGCTACTGG + Intergenic
1203244762 22_KI270733v1_random:55776-55798 GAACCCTCATATGCTGTTGGTGG - Intergenic
949743511 3:7263441-7263463 GCACCCTCATTGGCTGTGACAGG + Intronic
950149669 3:10676940-10676962 GAACTCTCATTCACTGCTTGTGG + Intronic
950290279 3:11778548-11778570 GAGCCCTCATGGGCTGCTAATGG - Intergenic
950339111 3:12226204-12226226 GAACCTTCATACACTGCTAGTGG + Intergenic
951095328 3:18622953-18622975 GAACTCTCATTCACTGCTAATGG + Intergenic
951232432 3:20194881-20194903 GAACCCTCATGTACTGCTGGTGG - Intergenic
951523884 3:23634808-23634830 GAACACTCATGCACTGCTAGTGG - Intergenic
951642551 3:24852390-24852412 GAACCCTCATGCACTGCTGGTGG + Intergenic
951797704 3:26559362-26559384 GAACCCTCATACACTGCTGGTGG + Intergenic
951926994 3:27918579-27918601 GAACCCTCATTTACTGCTGTTGG - Intergenic
952819055 3:37470328-37470350 GAACCTTCATACACTGCTAGTGG - Intronic
953012137 3:39036852-39036874 GAACCCTCATATACTGTTAGTGG + Intergenic
953192713 3:40702774-40702796 GAACTCTCATTCACTGCTGGTGG - Intergenic
953267826 3:41410074-41410096 AAACCCTCATATACTGCTAGTGG + Intronic
953331413 3:42056295-42056317 GAACCCTCACTCACTGCTGGTGG - Intronic
953600041 3:44353543-44353565 CAACTCTCATTCACTGCTAGTGG - Intronic
954589516 3:51769980-51770002 GAACTCTCATTCACTGCTAATGG - Intergenic
955280623 3:57591102-57591124 GAACCCTCATATATTGCTAGTGG + Intronic
956254397 3:67268366-67268388 GAACCTTCATTCATTGCTAGTGG + Intergenic
956550882 3:70458171-70458193 GAACCCTCATACGCTGTTAGTGG + Intergenic
956861692 3:73330567-73330589 GAACTCTCATTCATTGCTAGTGG + Intergenic
957152623 3:76505340-76505362 GAACTATCTTTAGCTGCTAGTGG - Intronic
957438127 3:80206262-80206284 GAACCCTCATATACTGCTGGTGG - Intergenic
958093548 3:88909461-88909483 GAACTCTCATTCATTGCTAGTGG - Intergenic
958738320 3:98036635-98036657 GAACTCTCATTCACTGCTAGTGG - Intergenic
959078046 3:101771905-101771927 GAACCATCATATACTGCTAGTGG - Intergenic
959413528 3:106055900-106055922 GAACTCTCATTCATTGCTAGTGG + Intergenic
959474728 3:106795806-106795828 GAACCCTCATACGCTGTTGGTGG + Intergenic
959607195 3:108254567-108254589 GAACCCTCATTCATTGCTGGTGG - Intergenic
960568544 3:119162112-119162134 GAACCCTCATACGCTGCTAGTGG + Intronic
960863631 3:122178793-122178815 GAACTCTCATTTGCTACTGGTGG + Intergenic
961507542 3:127380448-127380470 GAACACTCTTAGGCTGCTGGTGG + Intergenic
961541343 3:127601796-127601818 GAACCCTCATGTGTTGCTGGTGG - Intronic
961833746 3:129639615-129639637 GAACCCTCATATACTGCTGGTGG + Intergenic
961855058 3:129861740-129861762 GAACCCTCATACACTGCTGGTGG + Intronic
961985517 3:131128767-131128789 AAACTCTCATTCGCTGCTAGTGG - Intronic
962663806 3:137633430-137633452 GAACCCTCCTACACTGCTAGTGG + Intergenic
963026163 3:140921450-140921472 GAACTCTCATTTACTGCCAGTGG - Intergenic
964142800 3:153422450-153422472 GAACGCTCTTTGGCTGCAACAGG - Intergenic
964158255 3:153613121-153613143 AAACCCTCAATGGCTTCAAGAGG + Intergenic
964435680 3:156650397-156650419 GAACTCTCATAAGTTGCTAGTGG + Intergenic
964635538 3:158854276-158854298 GAACACTTATACGCTGCTAGTGG - Intergenic
965655548 3:170979811-170979833 GAATCCTCATTCACTGCTGGTGG - Intergenic
965769166 3:172162596-172162618 GAACCCTCATACACTGCTGGTGG - Intronic
965793817 3:172417115-172417137 GAACCCTCATACACTGTTAGTGG - Intergenic
966116694 3:176472213-176472235 GAACACTCATGTACTGCTAGTGG - Intergenic
966174752 3:177125424-177125446 AAACCCTCATTCACTGCTGGTGG + Intronic
966697431 3:182805237-182805259 GAACCCTCATACATTGCTAGTGG - Intronic
967800551 3:193653934-193653956 GAACTCTCATTCTCTGCTAGTGG + Intronic
968024819 3:195431813-195431835 GAACCCTCATGCACTGCCAGTGG - Intronic
968057899 3:195706923-195706945 GAACCCTCATACACTGCTGGTGG - Intergenic
968243198 3:197112094-197112116 CAACCCTCATTCACTACTAGTGG - Intronic
968527686 4:1071797-1071819 GAACTCTCATTCGTTGCTAGTGG + Intronic
970359040 4:15289150-15289172 GAACTCTCATTCACTGCTAGTGG + Intergenic
970504429 4:16712735-16712757 GAACCCTCATACATTGCTAGTGG + Intronic
971908347 4:32759246-32759268 GAACACTCATATGCTGCTAGTGG + Intergenic
972035999 4:34521794-34521816 GAACCCTCATGGACTGCTTGTGG - Intergenic
974199192 4:58616678-58616700 AAACCATCAATGGTTGCTAGGGG - Intergenic
975390262 4:73807998-73808020 GAACACTCATTCCCTGCTAGGGG + Intergenic
977278475 4:95009164-95009186 GAACTCTCATTCACTGCTAATGG + Intronic
977366274 4:96072349-96072371 GAACCCTCAAACGCAGCTAGTGG + Intergenic
977823081 4:101499151-101499173 GAACCCTCATTCATTGCTGGTGG + Intronic
977921118 4:102643510-102643532 GAACCCTCATATGTTGCTGGTGG - Intronic
978175399 4:105725447-105725469 GAACTCTCATTTACTGCTGGTGG - Intronic
978670479 4:111242854-111242876 GAACTCTCATTCATTGCTAGTGG + Intergenic
979515411 4:121603398-121603420 GAACTCTCATTGACTGCTGGTGG - Intergenic
980176320 4:129349656-129349678 GAACCCTCACACACTGCTAGTGG - Intergenic
980755709 4:137157189-137157211 GAACTCTCATTCATTGCTAGTGG - Intergenic
981297606 4:143150116-143150138 GAACCCTCATATGCTGTTGGTGG - Intergenic
981901236 4:149866384-149866406 GAACCCTGATATACTGCTAGTGG - Intergenic
982501244 4:156158916-156158938 AAACCCTCATAGACTGCTGGTGG + Intergenic
982735389 4:159001113-159001135 GAACTCTCATATACTGCTAGTGG - Intronic
983839588 4:172440031-172440053 GAACTCTCATTCATTGCTAGAGG + Intronic
984658112 4:182342016-182342038 AAACCCTCATACACTGCTAGTGG + Intronic
985036527 4:185845936-185845958 GAGCTCTCATTCACTGCTAGTGG + Intronic
985371949 4:189294659-189294681 GAACCCTCACTCGTTGCTGGTGG + Intergenic
987196757 5:15534770-15534792 GAACTCTCATTCACTGCTGGTGG - Intronic
987952194 5:24689483-24689505 GAACCCTCATACACTGTTAGTGG + Intergenic
988012031 5:25501281-25501303 GAACTCTCATTCACTGCTGGTGG - Intergenic
989477791 5:41894094-41894116 GAACCTTCATAGACTGCTGGTGG + Intergenic
989635878 5:43532968-43532990 GAACCCTCATGTGCTGCTGATGG + Intronic
990219440 5:53571639-53571661 GAACCCTCATTCACTGCTGGTGG - Intronic
990473292 5:56138053-56138075 GAACTCTCATTCACTGCTGGTGG + Intronic
990559805 5:56972606-56972628 GAACCCTCATGCACTGCTGGTGG + Intergenic
991153358 5:63398704-63398726 GACCTCTCATTGGCTCCCAGAGG + Intergenic
991521989 5:67510154-67510176 GAACTCTCATTCGTTGCTGGAGG + Intergenic
991908153 5:71533388-71533410 GAACCCTCATAAACTGCTGGTGG - Intronic
992094134 5:73344833-73344855 GAACTCTCATCCGCTGCTGGTGG - Intergenic
992519187 5:77532328-77532350 GAACTCTCAAATGCTGCTAGTGG + Intronic
993207011 5:84894997-84895019 GCACTCTCATGGGCTGGTAGTGG - Intergenic
993603682 5:89960183-89960205 GAACTCTCATTCGTTGCTGGTGG - Intergenic
994159642 5:96542394-96542416 GAACTCTCATTCATTGCTAGTGG - Intronic
994727888 5:103457885-103457907 GACCCCTCATGCACTGCTAGTGG - Intergenic
995139873 5:108723411-108723433 GAACTCTCATAGACTGCTGGTGG + Intergenic
995690539 5:114821331-114821353 GAACTCTCATACACTGCTAGTGG + Intergenic
995731748 5:115251207-115251229 GAACTCTCATTCACTGCTAAAGG - Intronic
995886198 5:116896792-116896814 GAACCCTCATACATTGCTAGTGG - Intergenic
996566569 5:124885422-124885444 GAACTCTCATTCACTGCCAGTGG + Intergenic
996645405 5:125809139-125809161 GAACCCTCAGGCACTGCTAGTGG + Intergenic
997083182 5:130765095-130765117 GAACCCTCGTACACTGCTAGTGG - Intergenic
998044853 5:138978648-138978670 GGACCCTCATATACTGCTAGTGG - Intronic
998080515 5:139271472-139271494 GAACCCTCATACACTGCTGGTGG - Intronic
998178451 5:139917028-139917050 GAACCCTCATACACTGCTGGTGG - Intronic
998504541 5:142661371-142661393 GAACCCTCATACACTGCTGGTGG + Intronic
999582453 5:153054373-153054395 GAACCCTTGTTCACTGCTAGTGG - Intergenic
999861452 5:155651556-155651578 GAACCCTTATTTGCTGCTGGTGG + Intergenic
999943696 5:156572359-156572381 GAACCCTCATACACTGCTGGTGG - Intronic
1000341778 5:160282845-160282867 GAACCCTCATATACTGCTGGTGG + Intronic
1000365031 5:160482621-160482643 GAACCCTCATACACTGCTGGTGG + Intergenic
1000496968 5:161996270-161996292 GAATCCTCATTCACTGTTAGTGG - Intergenic
1001248820 5:170129002-170129024 GAACCCTCATATACTGCTGGTGG + Intergenic
1001649773 5:173307696-173307718 GAACTCTCATTTGCTCCTGGCGG - Intergenic
1001917358 5:175573000-175573022 GAACCCTCATACACTGCTGGTGG + Intergenic
1002713832 5:181212690-181212712 GAACCCTCATTGGCTGGACAAGG + Intergenic
1003032124 6:2610821-2610843 GAACCCTCATTCATTGCTGGTGG - Intergenic
1003979094 6:11372608-11372630 GAACCCTCATATACTGTTAGTGG - Intronic
1004134432 6:12952823-12952845 GAACCCTCATTTATTGCTGGTGG - Intronic
1004696543 6:18039157-18039179 GAGCCCTCATTCAGTGCTAGGGG + Intergenic
1005297273 6:24438539-24438561 GAGCCCTCAGTGGCTTCTAGTGG - Intronic
1005354165 6:24966729-24966751 GAACCCACATTAGCAGCCAGGGG + Intronic
1006753929 6:36398251-36398273 GAACCCTCATACACTGCTGGTGG + Intronic
1007190562 6:40013409-40013431 GAACACTCATAGGCTGTTGGTGG - Intergenic
1007883240 6:45190943-45190965 GAACTCTCATTCACTGCTGGTGG + Intronic
1008740749 6:54604671-54604693 GAACGCTCATTTACTGCTGGTGG - Intergenic
1010787718 6:80024138-80024160 GAACCTTCATATGCTGCTAGTGG + Intronic
1011046899 6:83094514-83094536 GAACCCTCATACACTGCTGGAGG - Intronic
1011330624 6:86201978-86202000 GAACCCTCATACACTGCTGGTGG + Intergenic
1012059432 6:94459808-94459830 GAACCCTCATATGCTGTTGGTGG - Intergenic
1014251567 6:119120612-119120634 GAACCCTCATACGTTGTTAGCGG - Intronic
1015393248 6:132707322-132707344 GAACCCTCATACACTGTTAGTGG + Intronic
1016972875 6:149780960-149780982 GAACCCTCATACATTGCTAGTGG - Intronic
1017362022 6:153584960-153584982 GAACTCTCATTCACTGCTGGTGG - Intergenic
1017828475 6:158101471-158101493 GAACTCTCATTCACTGCTGGGGG - Intergenic
1017982442 6:159412756-159412778 GAGCCCTAATTGCCTGCTACAGG - Intergenic
1018233432 6:161699244-161699266 GAACCCTGATTCACTGCTAGTGG + Intronic
1018496496 6:164352088-164352110 GAACCCTCATGCTCTGATAGAGG - Intergenic
1018693813 6:166373702-166373724 GAACTCTCATTCGTTGCTGGTGG - Intronic
1019044905 6:169138020-169138042 GAACCCTCATACGCTGTTGGTGG + Intergenic
1019367300 7:640899-640921 GAACCCTCATACGTTGCTGGTGG + Intronic
1020449858 7:8308590-8308612 GAACACTCATTCACGGCTAGTGG - Intergenic
1020459093 7:8408046-8408068 GAGCCCTCATCGGCTGATGGGGG - Intergenic
1020726260 7:11819208-11819230 GAACTCTCATTCACTGCTGGTGG + Intronic
1021074949 7:16291158-16291180 GAACTCTTATACGCTGCTAGTGG + Intronic
1022154443 7:27645266-27645288 GAGCCCTCATACACTGCTAGTGG - Intronic
1022870688 7:34475513-34475535 AAACCCTCATATGCTGTTAGTGG - Intergenic
1023288881 7:38648395-38648417 GAACCCTCATATACTGCCAGTGG + Intergenic
1023372508 7:39526215-39526237 GAACCCTCATACACTACTAGTGG + Intergenic
1023392688 7:39725188-39725210 GAACCCTCATACGCTGCTGGTGG + Intergenic
1023596909 7:41839254-41839276 GAACCCTCACTCACTGTTAGTGG - Intergenic
1023935314 7:44735666-44735688 GAACCCTCATACACTGCTGGTGG + Intergenic
1024032757 7:45478276-45478298 GAACTCTCATTTATTGCTAGAGG + Intergenic
1024370580 7:48579500-48579522 GAACTCTCATTTGCTGCTGATGG + Intronic
1024509792 7:50194786-50194808 GAAGCCTCATACACTGCTAGTGG + Intergenic
1027336252 7:77153684-77153706 GAACCCTCACTCATTGCTAGTGG + Intronic
1027365415 7:77452567-77452589 GAACCCTCATACACTGCTGGTGG - Intergenic
1028823836 7:95245862-95245884 GCACCCTCACCGGCTCCTAGGGG - Intronic
1029187673 7:98751428-98751450 TAACTCCCATTCGCTGCTAGTGG + Intergenic
1029779536 7:102717418-102717440 GAACCCTCACTCATTGCTAGTGG - Intergenic
1029792242 7:102856772-102856794 GAACTCTCATATACTGCTAGTGG + Intronic
1029954464 7:104622920-104622942 GAACCCTCATTCACTGCTGCTGG - Intronic
1030282688 7:107793116-107793138 GAACCCTCATACACTGCTAGTGG + Intronic
1030294810 7:107912440-107912462 GAACCCTCATACACTGTTAGTGG - Intronic
1030604093 7:111620853-111620875 AAACCCTCATACACTGCTAGTGG - Intergenic
1030769419 7:113456136-113456158 GAACCCTCATTCACTGCTGGTGG + Intergenic
1031724425 7:125219816-125219838 GAACCCTCATACACTGCTGGTGG + Intergenic
1032912070 7:136444149-136444171 GAACTCTCAATCGTTGCTAGTGG - Intergenic
1033142990 7:138844376-138844398 GAAGCCCCATTTGCTGCCAGAGG - Exonic
1033483671 7:141766648-141766670 GAACCCTCACTTGCTGGTTGTGG - Intronic
1033488708 7:141818569-141818591 GAACCCTCATAGACTGTTGGTGG - Intergenic
1033668167 7:143463434-143463456 GAACACTCATGCACTGCTAGTGG - Intergenic
1034127053 7:148682781-148682803 GAACCCTCATATGCTGTTGGTGG + Intergenic
1034133333 7:148741361-148741383 GAACCCTCATACACTGCTGGTGG - Intronic
1034835061 7:154344445-154344467 GAACCCTCATACGCTGTTGGTGG + Intronic
1035148713 7:156847793-156847815 GAACTCTCATTAATTGCTAGTGG + Intronic
1035429738 7:158810057-158810079 GAACTCTCATTTGTTGCCAGTGG + Intronic
1035461977 7:159046104-159046126 GAACCCTCATATATTGCTAGTGG + Intronic
1036199620 8:6757348-6757370 GAACCCTACTTGGCTGCCTGTGG + Exonic
1036580269 8:10067630-10067652 GAACCCTCATTTATTGCTGGTGG - Intronic
1036729813 8:11252819-11252841 GAACCCTCATGCACTGTTAGTGG + Intergenic
1037427280 8:18770089-18770111 GAACCCTCATTCGCTGCTTGTGG - Intronic
1038001375 8:23394630-23394652 GAATCCTCATACGTTGCTAGTGG + Intronic
1038389002 8:27177407-27177429 GAACCCTCGTGGACTGCTAGTGG + Intergenic
1038442399 8:27580748-27580770 GAACCCTCATACATTGCTAGTGG - Intergenic
1038582436 8:28760623-28760645 GAACCTTCATACGCTGCTAGTGG - Intergenic
1038806663 8:30799955-30799977 GAACCCTCATACACTGCTGGTGG + Intronic
1041033979 8:53768313-53768335 GAACCCTCATTCACTGTTGGTGG + Intronic
1041488666 8:58408195-58408217 GAACTCTCATACACTGCTAGTGG - Intergenic
1041785133 8:61623167-61623189 GAACCCTCATGCACTGTTAGTGG - Intronic
1042127414 8:65552496-65552518 GAACTCTCATTCGTTGCTGGTGG - Intergenic
1042853710 8:73242684-73242706 GAACCCTCATTCACTGTTAGTGG + Intronic
1042864676 8:73346714-73346736 GAACCCTCATACGTTGCTGGTGG + Intergenic
1043113399 8:76216831-76216853 CAACCCTCATAGGTTGCTGGCGG - Intergenic
1043281964 8:78479453-78479475 GAACCCTCATACACTGCTGGTGG + Intergenic
1043845557 8:85159139-85159161 GAATCCTCATACACTGCTAGTGG + Intergenic
1043860228 8:85307832-85307854 GAACCCTCATACGTTGCTGGTGG - Intergenic
1044658801 8:94575234-94575256 GAACTCTCATTAACTGCTGGTGG + Intergenic
1044783516 8:95769586-95769608 GAACCCTCATTCATTGCTGGTGG - Intergenic
1044856313 8:96479564-96479586 GAACTCTCATTTATTGCTAGTGG + Intergenic
1045672285 8:104568805-104568827 GAACCCTCACATACTGCTAGTGG + Intronic
1047083418 8:121490471-121490493 GAACCCTCATACACTGCTAGTGG + Intergenic
1047917870 8:129602630-129602652 GATCCCTCATATACTGCTAGTGG - Intergenic
1048349528 8:133604908-133604930 GAACCCTCATATGCTGCTGGTGG + Intergenic
1048828224 8:138450458-138450480 GAACTCTCATTTGTTGCTGGTGG - Intronic
1050053533 9:1628058-1628080 GAAGTTTCATTGACTGCTAGTGG + Intergenic
1050364060 9:4857723-4857745 GAACCCTCATACACTGCTGGTGG - Intronic
1050374283 9:4954663-4954685 GAACTCTCATTTGTTGCTGGTGG + Intergenic
1050961020 9:11731306-11731328 GAACCCTTATTCTTTGCTAGTGG - Intergenic
1051201599 9:14632944-14632966 GAACCCTCAAATACTGCTAGTGG + Intronic
1051442288 9:17098302-17098324 GAACTCTCATTAACTGCTAACGG - Intergenic
1051645080 9:19260074-19260096 GAACCCTCATACACTGTTAGTGG - Intronic
1051789624 9:20785867-20785889 GAACCCTCATACACTGCTGGTGG - Intronic
1053068089 9:35082669-35082691 GAACCCTCATACACTGCTGGTGG + Intergenic
1053115873 9:35501692-35501714 GAACCATGGTTGGCTGCTACTGG - Intronic
1053125311 9:35576205-35576227 GGACCCTCATTGGCTGAAACAGG + Intergenic
1054142486 9:61540394-61540416 GAACACTCCTTGGCTTCCAGGGG - Intergenic
1055257892 9:74394017-74394039 TAACCCTAGTTGGATGCTAGGGG + Intergenic
1056104223 9:83330981-83331003 GAACTCTCATTCCCTGCTGGTGG + Intronic
1056510850 9:87304178-87304200 GAACCCTCATACACTGCTGGTGG + Intergenic
1056614232 9:88149384-88149406 GTACTCTCATTCACTGCTAGTGG + Intergenic
1057537414 9:95926117-95926139 GAACCCCCATCTGCTGCTGGTGG + Intronic
1057740534 9:97707521-97707543 GAACCCTCATATACTGCTGGTGG - Intergenic
1058346766 9:103972826-103972848 GAACTCTCATTCACTACTAGTGG - Intergenic
1059113270 9:111577340-111577362 GAACCCTCATACACTGCTTGTGG + Intronic
1060324882 9:122604434-122604456 GAATTCTCATTGGATGATAGAGG + Intergenic
1060370091 9:123060604-123060626 GAACTCTCAATGGTTGCTAATGG - Intronic
1060768912 9:126316297-126316319 GAACTCTCATTCATTGCTAGTGG + Intergenic
1061301491 9:129707973-129707995 GAACCCTCATACACTGCTGGTGG - Intronic
1061487677 9:130928633-130928655 GATCTCTCAGTGGCTGCTGGGGG + Intronic
1061504405 9:131023390-131023412 GAACCCTCATAGACTGCTGATGG - Intronic
1061676566 9:132219952-132219974 GAACCCTCATACGCTGCTGGTGG - Intronic
1062078930 9:134608798-134608820 GAACCCTCATTTGCTGCTGGTGG - Intergenic
1062379584 9:136280797-136280819 GCACCCTCCTTGGCTGGCAGCGG - Intergenic
1203461093 Un_GL000220v1:38859-38881 GAACCCTCATATGCTGTTGGTGG - Intergenic
1186376461 X:9007281-9007303 GAACCCTCAGACACTGCTAGTGG - Intergenic
1187069748 X:15876573-15876595 GAGCCCTCATACACTGCTAGTGG - Intergenic
1187194083 X:17065235-17065257 GAACCCTCATACACTGCTAGTGG - Intronic
1187516162 X:19973089-19973111 GAACCCTCATACACTGCTGGTGG - Intergenic
1187553771 X:20331884-20331906 GAACCCTCATATGCTGCTGGTGG - Intergenic
1187731657 X:22261608-22261630 GAACTCTCATAGACTGCTGGAGG + Intergenic
1187849452 X:23577253-23577275 GAACCCTCATTTGCTCTTGGTGG - Intergenic
1188287283 X:28343233-28343255 GAACCCTCATATACTGTTAGAGG - Intergenic
1188932600 X:36131275-36131297 GAAACCTCATGTGTTGCTAGAGG + Intronic
1189370636 X:40426167-40426189 GAACTCTCATTTGTTGCTGGTGG - Intergenic
1189956147 X:46276867-46276889 GAACCCTCATACGTTGCTGGTGG + Intergenic
1190001670 X:46694617-46694639 TAACCCTCATACGCTGCTGGTGG + Intronic
1190482820 X:50894378-50894400 GAACCCTCATATGCTGTTGGTGG + Intergenic
1190535634 X:51424016-51424038 GAACTCTCATATACTGCTAGTGG + Intergenic
1190860557 X:54340852-54340874 GAACCCTCATACACTGCTAGTGG + Intronic
1192281122 X:69687036-69687058 GAACCCTCATATGTTGCTTGTGG - Intronic
1192622223 X:72689827-72689849 GAACCCTCATACACTGCTGGTGG - Intronic
1193084340 X:77435915-77435937 GAACTCTCATTTCCTGCTGGTGG - Intergenic
1193172678 X:78354889-78354911 GAACCCTCATATGCTGTTGGTGG - Intergenic
1193197631 X:78653261-78653283 GAAACCTCATTGGAAGCAAGAGG - Intergenic
1193759593 X:85448204-85448226 GAACCCTCATACACTGCTGGTGG - Intergenic
1193769553 X:85572891-85572913 GAAACCCCATTGGCTAATAGCGG + Intergenic
1195309790 X:103620960-103620982 AAACCCTCATACGCTGCTGGTGG + Intronic
1195870807 X:109483334-109483356 GAACCCTCATATGTTGCTGGTGG - Intergenic
1196016564 X:110945526-110945548 GGATCCTCATTGGCTGAGAGAGG - Intronic
1196062776 X:111429287-111429309 GAACCCTCATACACTGGTAGTGG + Intergenic
1196087726 X:111703972-111703994 GAACTCTCATACGTTGCTAGTGG - Intronic
1196114088 X:111979852-111979874 GAACTCTCATATACTGCTAGAGG + Intronic
1196560511 X:117141898-117141920 GAACCCTCATACACTGCTGGTGG + Intergenic
1196749610 X:119103471-119103493 GAACCCTCATACATTGCTAGTGG + Intronic
1196776045 X:119338796-119338818 GAACTCTCATTCACTGCTGGTGG - Intergenic
1196902223 X:120396209-120396231 GAACCCTCATACATTGCTAGTGG - Intergenic
1197212457 X:123839392-123839414 GAACTCTCATTTGTTGCTGGTGG - Intergenic
1197661080 X:129173139-129173161 GAACCCTCATACGCTGTTGGTGG - Intergenic
1197730895 X:129809094-129809116 GAACCCTCAGGCACTGCTAGTGG + Intronic
1197791849 X:130263092-130263114 GAACCCTCATACACTGCTGGTGG + Intronic
1197876104 X:131108845-131108867 GAACCCTCATACGCTGTTGGTGG - Intergenic
1198406012 X:136313266-136313288 GAACCTTCATACACTGCTAGTGG - Intronic
1198451590 X:136771788-136771810 GAACCCTCATACACTGCTGGTGG + Intronic
1198513922 X:137384922-137384944 GAACCCTCATGCACTGCTGGTGG + Intergenic
1199017894 X:142840672-142840694 AAACCCTCATAGGCTGTTGGTGG - Intergenic
1199050874 X:143235391-143235413 GAACCCTCATAAGCTGTTGGTGG + Intergenic
1199288409 X:146079029-146079051 GAACCCTTATGCGCTGCTGGTGG + Intergenic
1201756294 Y:17489497-17489519 GAACCCTCATATATTGCTAGGGG + Intergenic
1201845258 Y:18416488-18416510 GAACCCTCATATATTGCTAGGGG - Intergenic
1202391730 Y:24377771-24377793 GAACCCTCATATGTTGCTAGTGG + Intergenic
1202479055 Y:25292346-25292368 GAACCCTCATATGTTGCTAGTGG - Intergenic