ID: 906972811

View in Genome Browser
Species Human (GRCh38)
Location 1:50534681-50534703
Sequence TGATTGATATACAACTTCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906972808_906972811 12 Left 906972808 1:50534646-50534668 CCTAGTTTAAAAGTGTCTATTTA 0: 1
1: 0
2: 0
3: 33
4: 381
Right 906972811 1:50534681-50534703 TGATTGATATACAACTTCACGGG 0: 1
1: 0
2: 2
3: 12
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906972811 Original CRISPR TGATTGATATACAACTTCAC GGG Intronic
900913621 1:5619359-5619381 TGATTGAGATACAAACACACTGG - Intergenic
902766094 1:18616397-18616419 TGATAGAAATGCAACTTCTCAGG - Intergenic
906840566 1:49134300-49134322 TCATTGATAAACATCTTAACAGG + Intronic
906972811 1:50534681-50534703 TGATTGATATACAACTTCACGGG + Intronic
907834351 1:58094855-58094877 TGATAGAAATACAACATCTCAGG - Intronic
908173661 1:61532509-61532531 TGATTAATTTATATCTTCACTGG - Intergenic
909033764 1:70573070-70573092 TGATTAATACACAAATTCAGGGG - Intergenic
911071246 1:93833381-93833403 TCATTGATAAACATCTTAACAGG + Intronic
911131886 1:94396924-94396946 TTCTTGAAATACAACATCACAGG - Intergenic
912097359 1:106161685-106161707 TCATTGATAAACATCTTAACAGG - Intergenic
912749972 1:112279296-112279318 TGATTGATACACAAAGTCACAGG + Intergenic
916489350 1:165287856-165287878 TGATTTATAGACAATTTCCCAGG + Intronic
916560523 1:165930897-165930919 TGATTGAAATGCAGCGTCACCGG + Intergenic
917293045 1:173491279-173491301 TGAAAGAAATACAACTTCAGAGG + Intergenic
918999621 1:191813677-191813699 TCATTGATAAACATCTTAACAGG + Intergenic
919010609 1:191957145-191957167 TGATTGATAAATTATTTCACAGG + Intergenic
921781011 1:219163617-219163639 TGATCACAATACAACTTCACTGG + Intergenic
922967928 1:229707404-229707426 TCATTGATAAACATCTTAACAGG - Intergenic
924732997 1:246729224-246729246 TCATTGATAAACATCTTAACAGG + Intronic
1064751798 10:18537905-18537927 TGATTGATAGACAACTTTTCTGG + Intronic
1065936231 10:30522838-30522860 TCATTGATAAACATCTTAACAGG - Intergenic
1066185361 10:33005393-33005415 TGAATCATCTGCAACTTCACAGG + Intronic
1066331413 10:34427486-34427508 TCATTGATAAACATCTTAACAGG - Intronic
1068152786 10:53155710-53155732 TCATTGATAAACATCTTAACAGG + Intergenic
1069072822 10:64007204-64007226 TCATTGATAAACATCTTAACAGG + Intergenic
1070114811 10:73518033-73518055 TGATTGGAATGCGACTTCACAGG - Intronic
1071777593 10:88806552-88806574 AAATTGATATACAAGTTCCCAGG - Intronic
1073003260 10:100301279-100301301 TCATTGATAAACATCTTAACAGG + Intronic
1074271381 10:111957163-111957185 TCATTGATAAACATCTTAACAGG - Intergenic
1075188379 10:120283902-120283924 TGATTCATATTCAAAATCACAGG + Intergenic
1076478470 10:130768578-130768600 TCATTGATAAACATCTTAACTGG + Intergenic
1077851332 11:6076755-6076777 TCATTGATAAACATCTTAACAGG - Intergenic
1079209091 11:18444816-18444838 GGATTGACAGTCAACTTCACTGG - Intronic
1083099258 11:60285851-60285873 TCATTGATAAACATCTTAACAGG + Intronic
1085268749 11:75256354-75256376 TGATCTATATTCAAGTTCACTGG + Intergenic
1085959459 11:81443469-81443491 TCATTGATAAACATCTTAACAGG + Intergenic
1085985014 11:81776238-81776260 TGATTGCTAAACACCTTCCCTGG + Intergenic
1086761835 11:90641156-90641178 TGTTTGGTATACAAGTCCACAGG + Intergenic
1087086057 11:94219863-94219885 TCATTGATAAACATCTTAACAGG + Intergenic
1087394043 11:97573922-97573944 TCATTGATAAACATCTTAACAGG - Intergenic
1087528691 11:99351702-99351724 TGATTTATATAGTAGTTCACTGG - Intronic
1094377098 12:29801876-29801898 TCATTGATAAACATCTTAACAGG + Intergenic
1096035803 12:48469125-48469147 TCATTGATAAACATCTTAACAGG + Intergenic
1097306921 12:58079612-58079634 TAATTCATCTACAACTTCAAAGG - Intergenic
1097515740 12:60603553-60603575 TCATTGATAAACATCTTAACAGG + Intergenic
1097777399 12:63664752-63664774 TGCTTTATTTTCAACTTCACTGG - Intronic
1098839122 12:75458017-75458039 TCATTGATAAACATCTTAACAGG + Intergenic
1099317571 12:81104087-81104109 TGTTTGATATACAACATCCTAGG - Intronic
1099766705 12:86996595-86996617 TGAGATATATACAAATTCACTGG - Intergenic
1100272961 12:93043781-93043803 TGATTGATATACTCATTCATCGG - Intergenic
1101986850 12:109453799-109453821 GAGTTCATATACAACTTCACAGG - Intronic
1104645686 12:130495686-130495708 TCATTGATATACACCCTCAAAGG - Intronic
1106299322 13:28449513-28449535 GGATTCATATACAAATTCAAAGG + Intronic
1107346087 13:39462529-39462551 TGAATGATATATAACTTTATAGG - Intronic
1108268624 13:48736700-48736722 ATATTGATATATAACTTCACAGG + Intergenic
1108799014 13:54070035-54070057 TCATTGATAAACATCTTAACAGG + Intergenic
1108902168 13:55425078-55425100 TCATTGATAAACATCTTAACAGG + Intergenic
1109250059 13:60008842-60008864 TGCTTGATAAACATCTTCACAGG - Intronic
1109755983 13:66760978-66761000 TCATTGATAAACATCTTAACAGG - Intronic
1110456947 13:75699771-75699793 TCATTGATAAACATCTTAACAGG + Intronic
1110464003 13:75780167-75780189 TCATTGATAAACATCTTAACAGG + Intronic
1110934913 13:81275964-81275986 TCATTGATAAACATCTTAACAGG - Intergenic
1113283688 13:108820519-108820541 TGGTTGTTACACAGCTTCACAGG - Intronic
1114394442 14:22344286-22344308 TCATTGATAAACATCTTAACAGG + Intergenic
1114998010 14:28383025-28383047 TGAGTGCTATAGAACTTCAAAGG - Intergenic
1117348424 14:54856911-54856933 TGCTTGATATTTGACTTCACTGG + Intronic
1119007817 14:70948064-70948086 TCATTGATAAACATCTTAACAGG - Intronic
1120295404 14:82633936-82633958 TCATTGATAAACATCTTAACAGG - Intergenic
1122592550 14:102865243-102865265 TCATTGATATAGAAGGTCACGGG + Intronic
1126267186 15:46768564-46768586 TCATTGATAAACATCTTAACAGG - Intergenic
1130728471 15:86465766-86465788 TCATTGATAAACATCTTAACAGG - Intronic
1133197285 16:4180167-4180189 TGAAAGATATACAGCGTCACAGG - Intergenic
1135309382 16:21393372-21393394 TGCTAGAAATGCAACTTCACAGG - Intergenic
1136148959 16:28333685-28333707 TGCTAGAAATGCAACTTCACAGG - Intergenic
1137223075 16:46474621-46474643 TGATGGCTATACAACTTTCCTGG - Intergenic
1138227184 16:55306080-55306102 TAATTGATACACTACTTCATAGG + Intergenic
1140079387 16:71730460-71730482 GGATGGATTTACGACTTCACAGG - Intronic
1141286121 16:82673760-82673782 TGATTGCTCCACAACTTTACAGG + Intronic
1143936082 17:10485321-10485343 TCATTGATAGACATCTTAACAGG + Intergenic
1149546498 17:57507768-57507790 TGTTTGATAGACAAATACACCGG - Intronic
1151036118 17:70802183-70802205 AGATTGATATACAATTGCCCTGG - Intergenic
1151435686 17:74095536-74095558 TGATAGATATCCAACTTAATCGG - Intergenic
1156548021 18:37985310-37985332 TGATTGACAGGCAACTTCAAAGG + Intergenic
1156908819 18:42386413-42386435 TGATTGAAATACTACTACATTGG + Intergenic
1156993581 18:43439650-43439672 TCATTGATAAACATCTTAACAGG - Intergenic
1163343161 19:16722963-16722985 TGCTGGCCATACAACTTCACTGG + Intronic
1164314584 19:24075677-24075699 TCATTGATAAACATCTTAACAGG + Intronic
1166236781 19:41462603-41462625 TCATTGATAAACATCTTAACAGG + Intergenic
1166912625 19:46170846-46170868 TCATTGATAAACATCTTAACAGG - Intergenic
1167437172 19:49486196-49486218 TGATTTATATACAATTTCATGGG - Exonic
1168670193 19:58235758-58235780 TGATTAAAAAACAACTTCATAGG + Intronic
925350658 2:3198885-3198907 TCATTGATAAACATCTTAACAGG + Intronic
925354854 2:3233095-3233117 TGATTGATATGCAGCTTTCCAGG + Intronic
928430175 2:31211612-31211634 TGATCTATATACAACTTCATTGG - Intronic
929254057 2:39790468-39790490 TCATTGATAAACATCTTAACAGG + Intergenic
929976787 2:46642917-46642939 TCATTGATAAACATCTTAACAGG + Intergenic
931578514 2:63746756-63746778 TCATTGATAAACATCTTAACAGG - Intronic
933106318 2:78330445-78330467 TCATTCATATACATCCTCACAGG + Intergenic
933598538 2:84306442-84306464 TCATTGATAAACATCTTAACAGG + Intergenic
934233490 2:90208485-90208507 TCCTTGATATACAAATTCTCAGG - Intergenic
935079270 2:99776590-99776612 TGTTTGAAATATAATTTCACAGG - Intronic
936694415 2:114929285-114929307 TCATTGATAAACATCTTAACAGG + Intronic
937163745 2:119793030-119793052 TCATTGATAAACATCTTAACAGG + Intronic
937170945 2:119868274-119868296 TAGTGGATATACTACTTCACTGG - Intronic
937198056 2:120177557-120177579 TGATTAATTTACAAGTTCTCAGG - Exonic
938088245 2:128415987-128416009 TGATTCATATATAACTGCTCTGG - Intergenic
938656502 2:133440061-133440083 TGTATGATATACTGCTTCACTGG + Intronic
939146917 2:138426387-138426409 TCATTGATAAACATCTTAACAGG - Intergenic
940577669 2:155532062-155532084 TCAATAATATACAACTTTACTGG + Intergenic
943750806 2:191507593-191507615 TCATTGATAAACATCTTAACAGG - Intergenic
944151285 2:196561343-196561365 TCATTGATAAACATCTTAACAGG - Intronic
945366479 2:208960725-208960747 TGATTGCTTTATAACGTCACTGG - Intergenic
947276473 2:228397458-228397480 TCATTGATAACCATCTTCACAGG + Intergenic
1172188316 20:33045630-33045652 TCATTGATAAACATCTTAACAGG - Intergenic
1172678741 20:36695686-36695708 TCATTGATAAACATCTTAACAGG - Intronic
1175093139 20:56521023-56521045 TCATTGATAAACATCTTAACAGG + Intronic
1177086168 21:16707565-16707587 ATATTGATATAAAACTACACTGG + Intergenic
1177195874 21:17902877-17902899 TGATATATAAACAACTGCACAGG + Intronic
1181047057 22:20220129-20220151 TGATTGATCCACAACTTCATGGG + Intergenic
1184632676 22:45796305-45796327 TCATTGATAAACATCTTAACAGG - Intronic
949638914 3:6013563-6013585 TCATTGATAAACATCTTAACAGG - Intergenic
951357829 3:21690727-21690749 TGTTAGATATTCAAATTCACTGG + Intronic
952051861 3:29393987-29394009 TCATTGATAAACATCTTAACAGG + Intronic
952444843 3:33371132-33371154 TGGCTGATATAAAACTTTACTGG - Intronic
957353196 3:79052367-79052389 TCATTGATAAACATCTTAACAGG - Intronic
957354156 3:79060219-79060241 TCATTGATAAACATCTTAACAGG - Intronic
957763529 3:84591005-84591027 TGATTGAAATACAACTATATTGG - Intergenic
959824700 3:110779788-110779810 TGTTAGAGATACAAATTCACAGG - Intergenic
961856031 3:129872376-129872398 TAATAGATATACAAATTCTCAGG + Intronic
961919220 3:130408458-130408480 TCATTGATAAACATCTTAACAGG - Intronic
962625172 3:137219032-137219054 TGTTAGAAATACAACTTCTCAGG + Intergenic
963808162 3:149747401-149747423 TGATTCTCATTCAACTTCACAGG - Intronic
964894735 3:161581971-161581993 TGATTTATTTACATCTTTACTGG + Intergenic
965611673 3:170550409-170550431 TGATTCAAATACTACTGCACAGG + Intronic
967384096 3:188893980-188894002 TTATTTATATACTACTTCAGTGG + Intergenic
968396891 4:247267-247289 TCATTGATAAACATCTTAACAGG + Intergenic
970629049 4:17921657-17921679 TGGTTAATATTCAACTTGACTGG + Intronic
973103838 4:46305691-46305713 AGATGCATATACAACTTCAGAGG - Exonic
974677374 4:65110971-65110993 TGCTTTATATAAAACTTCACAGG - Intergenic
975511423 4:75197627-75197649 TGATTGCTATACAGTGTCACCGG + Intergenic
976873650 4:89828044-89828066 TGATTGTTTTACAATTTCATAGG + Intronic
976983070 4:91256302-91256324 TCATTGATAAACATCTTAACAGG - Intronic
977674624 4:99733540-99733562 TCATTGATAAACATCTTAACAGG + Intergenic
978459449 4:108934806-108934828 TGATTTATACAAAACTTTACAGG + Intronic
979993845 4:127407762-127407784 TCATTGATAAACATCTTAACAGG - Intergenic
980073269 4:128265609-128265631 TCATTGATAAACATCTTAACAGG + Intergenic
980214878 4:129839028-129839050 TGGTTGCTCTACATCTTCACAGG - Intergenic
980577222 4:134699003-134699025 TCATTGATAAACATCTTAACAGG - Intergenic
984905947 4:184625957-184625979 TCATTGATAAACATCTTAACAGG + Intergenic
986900712 5:12429483-12429505 TTATTGATGTTCAACTCCACAGG - Intergenic
988261215 5:28887845-28887867 TAATTGAAATACAGTTTCACAGG - Intergenic
988669662 5:33367549-33367571 TGAGGGATTTACAACTTCAGGGG - Intergenic
989513902 5:42319661-42319683 TCATTGATAAACATCTTTACAGG + Intergenic
989544208 5:42653880-42653902 TGGTTGACCTACAACTTCAAGGG + Intronic
990240472 5:53811744-53811766 TGATGGAAATACAACCTCTCAGG - Intergenic
990682249 5:58258129-58258151 TGAATGATATACAACCTTCCAGG + Intergenic
991250798 5:64558962-64558984 TCATTGATAAACATCTTAACAGG - Intronic
993367231 5:87049099-87049121 TCATTGATAAACATCTTAACAGG + Intergenic
993411309 5:87576558-87576580 TCATTGATAGACATCTTAACAGG - Intergenic
993491308 5:88553876-88553898 TGATTAATAAACAAGTTCAGTGG + Intergenic
995374563 5:111459448-111459470 TGGGTGATATAAAACTTAACAGG - Intronic
996146842 5:119987139-119987161 TCATTGATAAACATCTTAACAGG + Intergenic
997489632 5:134262724-134262746 TCATTGATAAACATCTTAACAGG + Intergenic
997491890 5:134284510-134284532 TCATTGATAAACATCTTAACAGG + Intergenic
1000691526 5:164327234-164327256 TCATTGATAAACATCTTAACAGG + Intergenic
1004267213 6:14159168-14159190 TCATTGATAAACATCTTAACAGG + Intergenic
1004744241 6:18493984-18494006 AGATTTATATACAACTGCACTGG - Intergenic
1006286657 6:33101212-33101234 TCATTGATAAACATCTTAACAGG + Intergenic
1008502792 6:52200144-52200166 TCATTGATAAACATCTTAACAGG + Intergenic
1008605872 6:53139252-53139274 TGATTTACATACAACTTTTCAGG + Intronic
1009245906 6:61237325-61237347 TCATTGATAAACATCTTAACAGG - Intergenic
1009630865 6:66198364-66198386 TCATTGATAAACATCTTAACAGG - Intergenic
1011357667 6:86489321-86489343 TCATTGATAAACATCTTAACAGG - Intergenic
1013560633 6:111301236-111301258 TCATTGATAAACATCTTAACAGG - Intronic
1013714465 6:112942349-112942371 TTATAGATATGCAACTTCAATGG + Intergenic
1013855256 6:114564635-114564657 TCATTGATAAACATCTTAACAGG - Intergenic
1014352156 6:120358848-120358870 TCATTGATAAACATCTTAACAGG - Intergenic
1015341848 6:132109824-132109846 TCATTGATAAACATCTTAACAGG + Intergenic
1018399561 6:163409217-163409239 TGATTGCAAGACAATTTCACAGG - Intergenic
1020934960 7:14451184-14451206 TCATTCATAGACACCTTCACAGG - Intronic
1021779230 7:24085896-24085918 TTATTCATAAACAACTTCAAAGG + Intergenic
1022360922 7:29656423-29656445 TGCTTTATTTTCAACTTCACTGG + Intergenic
1022684067 7:32578193-32578215 TTATAGAGATAAAACTTCACAGG + Intronic
1022700776 7:32758196-32758218 TGCTTTATTTTCAACTTCACTGG - Intergenic
1022936327 7:35182419-35182441 TGCTTTATTTTCAACTTCACTGG - Intergenic
1023668870 7:42555239-42555261 TCATTGATAAACATCTTAACAGG - Intergenic
1024552040 7:50570554-50570576 TCATTGATAAACATCTTAACAGG - Intergenic
1024553514 7:50583580-50583602 TCATTGATAAACATCTTAACAGG - Intergenic
1024756665 7:52541439-52541461 TCATTGATAAACATCTTAACAGG + Intergenic
1027342030 7:77219999-77220021 TCATTGATAAACATCTTAACAGG + Intronic
1028373794 7:90123155-90123177 TGCTTTATTTTCAACTTCACTGG + Intergenic
1028550660 7:92059764-92059786 TAATTTATATACAACTACATGGG - Intronic
1029832545 7:103276534-103276556 TGCTTTATTTTCAACTTCACTGG - Intergenic
1030411215 7:109182567-109182589 TCATTGATAAACATCTTAACAGG + Intergenic
1030432455 7:109468189-109468211 TGATTGATTCACAACTTCAGTGG + Intergenic
1031220743 7:118962122-118962144 TTTTTGATATCCAACCTCACTGG - Intergenic
1031513912 7:122679429-122679451 TCATTGATAAACATCTTAACAGG - Intronic
1031798095 7:126203703-126203725 TGTTTGATATACAGCCTCAGTGG + Intergenic
1032768934 7:135028594-135028616 TGAGGGCTACACAACTTCACTGG - Intronic
1033627058 7:143120593-143120615 AGAATGATGTAAAACTTCACTGG + Intergenic
1035609464 8:950289-950311 TGATTGTGATACAATTTGACAGG + Intergenic
1041210460 8:55545346-55545368 TCATTGATAAACATCTTAACAGG - Intergenic
1041414977 8:57597907-57597929 TCATTGATAAACATCTTAACAGG - Intergenic
1042386304 8:68178855-68178877 TGATTGCAATACAACTTCACTGG - Intronic
1043339323 8:79218555-79218577 TGATGCATATGCAATTTCACTGG + Intergenic
1044277572 8:90320443-90320465 TGATTTATATACAACTTTACAGG + Intergenic
1044362031 8:91296960-91296982 TGTTTGATCTACCAGTTCACAGG - Intronic
1045128139 8:99117236-99117258 TCAGTGAGATACCACTTCACAGG + Intronic
1045148669 8:99377960-99377982 TCATTGATAAACATCTTAACAGG + Intronic
1045813993 8:106258213-106258235 TCATTGATAAACATCTTAACAGG - Intergenic
1046044045 8:108942646-108942668 TCATTGATAAACATCTTAACAGG - Intergenic
1046191311 8:110798605-110798627 TCATTGATAAACATCTTAACAGG + Intergenic
1046365543 8:113226093-113226115 TGATTGATTCACAGATTCACAGG - Intronic
1046466915 8:114616908-114616930 TAATCGATATACAACTTGAGTGG + Intergenic
1047977009 8:130140604-130140626 TGATTGACCCACAACTTCAGTGG + Intronic
1050746400 9:8881254-8881276 TGACTGATATACAACTTTTTAGG - Intronic
1051417516 9:16858042-16858064 TTATTTATATAAAACTTCACTGG + Intronic
1052061105 9:23962375-23962397 TCATTGATAAACATCTTAACAGG - Intergenic
1052777189 9:32743741-32743763 TCATTGATAAACATCTTAACAGG + Intergenic
1055055003 9:72015319-72015341 TGATAAATATACAATTTCCCAGG - Intergenic
1055394198 9:75856340-75856362 TGATTTATTTTCAACATCACAGG - Intergenic
1057467560 9:95329632-95329654 TGAGTTAAATACAAATTCACTGG + Intergenic
1185572302 X:1144443-1144465 TAATTGAAATACAATATCACAGG + Intergenic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1187976058 X:24706542-24706564 TGGTTGAAATCCAACATCACTGG + Intronic
1188256282 X:27965438-27965460 TCATTGATAAACATCTTAACAGG + Intergenic
1188446207 X:30255762-30255784 TCATTGATAAACATCTTAACAGG + Intergenic
1188595241 X:31892332-31892354 TGATGGGCATAGAACTTCACCGG + Intronic
1188753007 X:33926534-33926556 TCATTGATAAACATCTTAACAGG - Intergenic
1188880122 X:35482096-35482118 TGATTTATCTTCAAGTTCACTGG - Intergenic
1188913749 X:35883950-35883972 TTACTGATACACAACTTGACTGG - Intergenic
1189726606 X:43973539-43973561 TGATTGATATATGACTGCAATGG - Intergenic
1190152773 X:47962096-47962118 TCATTGATAAACATCTTAACAGG + Intronic
1191654508 X:63581514-63581536 TCATTGATAAACATCTTAACAGG + Intergenic
1191721981 X:64238796-64238818 TCATTGATAAACATCTTAACAGG + Intergenic
1192753908 X:74025234-74025256 TCATTGATAAACATCTTAACAGG + Intergenic
1193052204 X:77113429-77113451 TGATTGATTTACAGTGTCACTGG - Intergenic
1193561948 X:83029560-83029582 TCATTGATAAACATCTTAACAGG + Intergenic
1193602877 X:83529967-83529989 TGGATGATATACAATCTCACTGG + Intergenic
1193712097 X:84893143-84893165 TCATTGATAAACATCTTAACAGG - Intergenic
1195604670 X:106791633-106791655 TGATTTATACCCAACTTCTCTGG + Intronic
1196311133 X:114167326-114167348 TCATTGATAAACATCTTAACAGG + Intergenic
1197028988 X:121790691-121790713 TGAGTGATATAGAAAGTCACTGG - Intergenic
1198284280 X:135174351-135174373 TGATTGAAAAAAAACATCACTGG + Intergenic
1200299219 X:154955850-154955872 TCATTGATAAACATCTTAACAGG + Intronic
1200714569 Y:6523265-6523287 TAAGTGATTTATAACTTCACAGG + Intergenic
1201019256 Y:9637893-9637915 TAAGTGATTTATAACTTCACAGG - Intergenic
1202265937 Y:23019220-23019242 TCATTGATAAACATCTTAACAGG - Intergenic
1202418930 Y:24652963-24652985 TCATTGATAAACATCTTAACAGG - Intergenic
1202451856 Y:25017123-25017145 TCATTGATAAACATCTTAACAGG + Intergenic