ID: 906976677

View in Genome Browser
Species Human (GRCh38)
Location 1:50581780-50581802
Sequence ATGAAGAAAGAGTAAGATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 640
Summary {0: 1, 1: 1, 2: 3, 3: 47, 4: 588}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906976672_906976677 22 Left 906976672 1:50581735-50581757 CCAGGTAAAGAGCAGAATGAAAG 0: 1
1: 0
2: 4
3: 26
4: 262
Right 906976677 1:50581780-50581802 ATGAAGAAAGAGTAAGATTATGG 0: 1
1: 1
2: 3
3: 47
4: 588

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906976677 Original CRISPR ATGAAGAAAGAGTAAGATTA TGG Intronic
901586082 1:10294095-10294117 ATGAAAGAAGAGTCAGATGAGGG - Intronic
901915398 1:12495594-12495616 ATGGAGAAATAGTCAGATTTGGG + Intronic
902613726 1:17612345-17612367 ATGAAGAGACAGTCAGATGAAGG - Intronic
903079604 1:20798970-20798992 ATGAAGAAAGGGTGACAGTATGG - Intergenic
903568355 1:24285643-24285665 ATCAAGAAAGAGAAATATTTGGG - Intergenic
904957445 1:34296788-34296810 ATGAGGACACAGTAAGAATATGG + Intergenic
905778605 1:40687821-40687843 TTGAAAAATGAGTAAAATTAGGG - Intergenic
905846244 1:41235229-41235251 ATAAAGAAATACTAATATTAGGG - Intronic
906816093 1:48881129-48881151 ATGAACAAAGAGTAATAAAAAGG - Intronic
906976677 1:50581780-50581802 ATGAAGAAAGAGTAAGATTATGG + Intronic
907050628 1:51327613-51327635 GTGAAGAATGACTAAGACTATGG + Intronic
907071085 1:51535508-51535530 ATGAAGAAATAGAAACAGTATGG - Intergenic
907824537 1:58002431-58002453 ATGAATAAAGTGGAAGAATATGG - Intronic
908620963 1:65979022-65979044 TTGAAGAAAGATGAAGATGATGG - Intronic
908638321 1:66192906-66192928 ATGAAGAAACAAAAAGTTTAAGG + Intronic
909158429 1:72112699-72112721 ATGAAGAAAGAGTGATCTGAAGG + Intronic
909276611 1:73695031-73695053 ATGAATAAAGAGGAAGACTTTGG + Intergenic
909712107 1:78663324-78663346 ATGAAGAGGGACTAAGATGAAGG - Intronic
909756027 1:79227150-79227172 ATCAAGAAAGAGTAGGAAAATGG - Intergenic
909819508 1:80043592-80043614 GAGAAGAAAGGGTAAGATTTGGG - Intergenic
909896681 1:81079968-81079990 ATGAGGAAAGAATAGGACTAAGG - Intergenic
911524496 1:98967453-98967475 ATGAAGAAGGGATGAGATTAGGG + Intronic
911550331 1:99271030-99271052 ATGAAGAAACAGTAAGATAGTGG - Intronic
911818132 1:102380954-102380976 ATGAACAAAGAAAAAGATTAGGG - Intergenic
911867152 1:103043282-103043304 ATGACCAAACAGTAAGTTTAAGG + Intronic
911930983 1:103903369-103903391 ATCAAGAAAGAATAAAATTAAGG + Intergenic
912968352 1:114257193-114257215 ATGATGGAACAGAAAGATTAAGG - Intergenic
913000316 1:114573726-114573748 AAGAAGAAAGAATGGGATTAGGG - Intronic
914873506 1:151494896-151494918 ATGAAGAAAGAGTGACAGTGTGG + Intergenic
915444081 1:155964951-155964973 GTGAAGGAAGAGGAAGACTAGGG + Intronic
915688665 1:157663698-157663720 ATGAAGAAAGTGCAAAATAATGG + Intergenic
916622111 1:166510580-166510602 TTGAAGAAAGAGTGAGAGAAAGG + Intergenic
916932405 1:169592318-169592340 ATGGAGAAAGAATAAGAGTAAGG + Intronic
917241791 1:172956645-172956667 AAGAAGTAAGAGAAAGATAATGG + Intergenic
917289553 1:173458463-173458485 ATGTAGAAAGAGAAAGAGTAGGG + Intergenic
917628252 1:176867410-176867432 ATTAGGAATGAGTAAGAATAAGG + Intronic
917628305 1:176868041-176868063 ATGAAGAAAAAATAAAAATAGGG - Intronic
917644311 1:177014894-177014916 AGGAAGAAAGAGAAACATGAAGG + Intronic
918889810 1:190252462-190252484 ATGAGGATATAGAAAGATTAAGG + Intronic
919454868 1:197809395-197809417 TTGAAGAAAAAGTAAGCTTTTGG - Intergenic
920219229 1:204384208-204384230 AGTGAGAAAGAGTAAGATTCTGG + Intergenic
921005052 1:211085099-211085121 TTGAACAATGAGTAAGATTTAGG + Intronic
922171677 1:223160656-223160678 AGGAAGAAAGTATAAGAATAGGG - Intergenic
922317176 1:224452818-224452840 AAGAAGATAGCTTAAGATTATGG + Intronic
922582109 1:226706187-226706209 ATTTAGAAAGATTAAGATGATGG + Intronic
923203446 1:231734370-231734392 CTGAAGAAAGAGCTTGATTATGG - Intronic
923908213 1:238409521-238409543 GTGAAGAAAGAGTATAATTGAGG - Intergenic
923931517 1:238704497-238704519 ATGAAAAGAGATGAAGATTATGG - Intergenic
924168799 1:241315009-241315031 TTGAAGACAGAGTAAGAAAAAGG + Intronic
924392171 1:243573911-243573933 ATGAAGAAAGAGCAGGTTTCAGG + Intronic
924685900 1:246289168-246289190 ATGAAAAAAGAAAAAGATTAGGG + Intronic
924849834 1:247816127-247816149 ATGTAGGAAGAGCAAGACTATGG - Intergenic
1062799163 10:367115-367137 AGGAAGAAAGATTCACATTAAGG + Intronic
1063549616 10:7018081-7018103 ATTAAGAAAGAAACAGATTAAGG + Intergenic
1063707138 10:8441352-8441374 TTGGAGAAAGACTGAGATTATGG - Intergenic
1063732137 10:8709924-8709946 AGGAAGGAAGAGAAAGATGAAGG - Intergenic
1064951270 10:20853695-20853717 ATGAAGACAGAGTAGAATGATGG + Intronic
1065762428 10:28994597-28994619 ATGAGGAAGGAGGAAGATTAAGG - Intergenic
1068345080 10:55765804-55765826 GTGAAGAAAGAGTAATGTGAAGG - Intergenic
1068347838 10:55807109-55807131 ATGAAGAAAGTGAAAGCCTATGG + Intergenic
1068692351 10:59930223-59930245 AAGAAGAAAGAGAAAAATGAAGG - Intergenic
1068694068 10:59947031-59947053 ATGAAAAAAGACTAGGCTTATGG - Intergenic
1068958960 10:62847300-62847322 ATGGAAAAAGAGCAAGAGTATGG + Intronic
1069207408 10:65708407-65708429 ATAAAGAAAGAGAGAGATTGAGG - Intergenic
1069356299 10:67589541-67589563 ATAATGAGAGAGAAAGATTATGG - Intronic
1070640112 10:78162252-78162274 CTGAATAAAGATTAAGAATATGG - Intergenic
1071254999 10:83864429-83864451 ATGAAGATAGAGTAATGGTAGGG + Intergenic
1071703528 10:87970111-87970133 ATGGAAAAACAGCAAGATTATGG - Exonic
1071948694 10:90678052-90678074 ATGCAGAAAGAGAAAGAGTATGG - Intergenic
1072410820 10:95200581-95200603 ATGAAGAAAGAAGAAGAAGAAGG + Intronic
1072947656 10:99825025-99825047 ATCAAGAAAGAGAAGGAATAGGG - Intronic
1073053570 10:100684970-100684992 ATGAAGAAAAAGAAAGAGTTGGG + Intergenic
1073172217 10:101520073-101520095 ATGAAGAAAAAGCAGGATAAGGG - Intronic
1073693646 10:105840224-105840246 ATGTAGAGAGAGAGAGATTAAGG - Intergenic
1073863709 10:107776368-107776390 ATAAAGAAAGAGTAAAATCATGG + Intergenic
1074685729 10:115960916-115960938 ATAAAGACAGAGAAAGATCAAGG + Intergenic
1075456708 10:122589591-122589613 ATGAAGAAAGAGGCAGATTTGGG + Intronic
1075524695 10:123173930-123173952 GAGAAGAAAAAATAAGATTAGGG + Intergenic
1076046466 10:127298135-127298157 ATGAACAAATACTAAAATTATGG - Intronic
1076194388 10:128505786-128505808 AGGAAGAAAGAGGAAAATTAGGG - Intergenic
1077346236 11:2057094-2057116 ATGGAGAAAGAAGAAGAATATGG - Intergenic
1077880079 11:6342220-6342242 GGGAAGAAAGAGTAAGAGTGTGG - Intergenic
1078028498 11:7723302-7723324 TTGAAGAATGAGCAAGATTTCGG + Intergenic
1078316773 11:10300120-10300142 CTGAAGAAAAAGCAAGACTAGGG - Intergenic
1078391980 11:10943055-10943077 ATGAAGAAAGAATACAATAAAGG - Intergenic
1079057079 11:17215605-17215627 CTGGAGAAGGTGTAAGATTAAGG - Intronic
1079411292 11:20190226-20190248 CTGAAGAAAGAGTAGGAGTGAGG - Intergenic
1079620162 11:22544115-22544137 ATGGAGAAAAGGGAAGATTACGG - Intergenic
1079778354 11:24562922-24562944 ATGATGAAAGGGTAAGATTGTGG + Intronic
1080381231 11:31774215-31774237 AAGACGAAAGAGTGAGATAAGGG - Intronic
1080384452 11:31802906-31802928 AAGAAGGAAGAGGAAGATGAGGG + Intronic
1080554446 11:33403037-33403059 TTGACAACAGAGTAAGATTATGG + Intergenic
1081264537 11:41003954-41003976 ATAAAGAAAGAGTGTGCTTATGG + Intronic
1081314595 11:41616428-41616450 AGGTAGAAAGCCTAAGATTAAGG + Intergenic
1081927353 11:46841972-46841994 CTGGAGAAAGAGTAAGACTTTGG + Intronic
1083010278 11:59390651-59390673 ATGAAAAAAGAATGAGATTATGG + Intergenic
1086461357 11:87008833-87008855 ATTAAAAAAGAGTAAGATCAGGG - Intergenic
1087711545 11:101559303-101559325 ATGAATACAGTGTAAAATTAGGG - Intronic
1088208818 11:107428975-107428997 GTGAAGAAAGATTAACATCATGG - Exonic
1088379435 11:109177001-109177023 ATGAAATAATAGTAATATTAGGG - Intergenic
1089126360 11:116179297-116179319 ATGAAGAAAAAGTGGGATAAGGG + Intergenic
1089236712 11:117034082-117034104 AAAAAGAAAGCCTAAGATTATGG + Intronic
1089471665 11:118726274-118726296 ATCAAGAAAGAGAAGGAATAGGG - Intergenic
1089830601 11:121324227-121324249 AGGAAGAAAGTGTAAGAGTGTGG - Intergenic
1090148761 11:124358821-124358843 ATGAAGAAATAATGAGATGAGGG - Intergenic
1090153651 11:124413153-124413175 CTGAAGAATGAGTAAGACTTAGG + Intergenic
1091579748 12:1777069-1777091 GAGAAGAAAGAGTAAGATGGAGG + Intronic
1093102896 12:15049200-15049222 ATGAGGAAAGAGAAAAATAAAGG + Intergenic
1093274487 12:17107236-17107258 ATGGAGAAAGAGCTAGATTTGGG + Intergenic
1094099784 12:26749696-26749718 ATGAAGAAAATGGAATATTAAGG - Intronic
1095298605 12:40556250-40556272 ATGAAAGGAGAGTAAGAATAAGG + Intronic
1095457609 12:42405556-42405578 AAAAAGAAAGAGGAAGAGTAAGG - Intronic
1095542950 12:43331606-43331628 ATAAGGAAAGAATAAGAATAAGG + Intergenic
1095628102 12:44342012-44342034 ATGAAGTACAAGTAAGAATATGG - Intronic
1096480252 12:51935489-51935511 ATGAAGAGAGAGGAGGACTATGG - Intergenic
1097147989 12:56954750-56954772 ATCCAGAAAGAGGAAGATGAGGG + Intronic
1097469089 12:59966443-59966465 AAGAAGAAAGAGGAAGAGAAAGG - Intergenic
1097633208 12:62089551-62089573 ATAAAGAAAGAGTGAGAGAAAGG + Intronic
1097809809 12:64006269-64006291 ATGAAGCTAGAGAAAGATAAGGG + Intronic
1097921829 12:65084120-65084142 AAGAAGAAAGGATAAGATTTTGG - Intronic
1098096600 12:66963480-66963502 ATGAAGAAAAAGAAGGAATAAGG + Intergenic
1098189960 12:67937656-67937678 AAGTAGAAAGAATAAGATTCTGG + Intergenic
1098581595 12:72105445-72105467 GTGGAGGAAAAGTAAGATTATGG + Intronic
1099331492 12:81294549-81294571 TTGAAAAAAGAGTAAGCTCAGGG + Intronic
1099483783 12:83201648-83201670 ATGAAGAGAGAGATAGATTAAGG - Intergenic
1099499887 12:83401254-83401276 ATGCAGAAAGAATAAGAATCAGG - Intergenic
1099536307 12:83849291-83849313 ATGAAGAAGGAGTAAGAGTTTGG - Intergenic
1100057502 12:90530158-90530180 TTGAATAAAAAGTAAAATTATGG - Intergenic
1100948093 12:99810522-99810544 ATGAAAAAATACTAAAATTATGG + Intronic
1101178357 12:102181496-102181518 ATAAAGAAATAGTAACATAAAGG + Intronic
1101811940 12:108115036-108115058 AGGAAGAAAGAGAAAGAGGAAGG + Intergenic
1102092126 12:110200051-110200073 AAAAAGAAAGGGTAACATTATGG - Intronic
1102570347 12:113823535-113823557 ATGAAGAAAGATAAGGAGTAGGG + Intronic
1103251216 12:119501578-119501600 CTGATGAAAGAGTAAGAAAATGG - Intronic
1103274660 12:119701339-119701361 ATGAGGACAGAGTAAGAGAAAGG + Intronic
1104041098 12:125131560-125131582 ATGAATAATGAGTATGAATATGG + Intronic
1105539498 13:21303123-21303145 ATAAAAAAAGAATGAGATTATGG - Intergenic
1105675184 13:22663858-22663880 ATCTAGAAAGAGAAATATTAGGG - Intergenic
1105800361 13:23897730-23897752 ATAAAGAAAAAGTAGGATGATGG + Intronic
1106766199 13:32916352-32916374 CTTCAGAAAGAGTTAGATTAGGG - Intergenic
1106946209 13:34830487-34830509 ATGAAGAAAAACTAAGAATGAGG - Intergenic
1107360270 13:39610146-39610168 ATGTAGAAAGATGAATATTATGG + Intergenic
1108807325 13:54175234-54175256 ATGAGGAGAGAGTAGCATTATGG - Intergenic
1109782134 13:67125728-67125750 ATGCAAAATGAGTAAGAATATGG - Intronic
1109977231 13:69854337-69854359 ATGAAGAAAGAGAGAGAGCATGG + Intronic
1111440324 13:88274066-88274088 ATCAAGAAAGAGTAGAACTAGGG + Intergenic
1112111717 13:96307144-96307166 ATTAAGAAAGAGTAAGAAAGAGG + Intronic
1112744410 13:102510404-102510426 ATTAAGCAAGAGTAAGAGTGAGG - Intergenic
1112786251 13:102954912-102954934 AAGAAGAAAGAGGAAGAGGAGGG - Intergenic
1114204635 14:20557371-20557393 ATGGAGCAAGAGAGAGATTAAGG + Intronic
1114398233 14:22386243-22386265 ATGAATGAACAGTAATATTAAGG + Intergenic
1114736921 14:25051191-25051213 ATAAAGACAGGGTAAGTTTAGGG - Intergenic
1114822634 14:26040060-26040082 AGGATGAAAGAGAAAGATCAGGG - Intergenic
1115342535 14:32307801-32307823 ATCAAGAAAGAAGAAGATTAGGG - Intergenic
1115435645 14:33369989-33370011 ATGAAGAAAGAGTAGGAAGGAGG - Intronic
1116117259 14:40670657-40670679 ATTAACAAAGAGAAATATTATGG - Intergenic
1116236887 14:42289677-42289699 ATGAATAAATAATAAGAATATGG - Intergenic
1116464090 14:45212233-45212255 AGGAAGAGAGAGAGAGATTAGGG - Intronic
1116596913 14:46860993-46861015 ATGAATAAAGAGGAAGAAAATGG - Intronic
1116791529 14:49345059-49345081 ATGAAGAAATACAAAAATTAGGG + Intergenic
1117487702 14:56214473-56214495 AGGAAGAGAGATTAAAATTAAGG - Intronic
1117810795 14:59544574-59544596 ATGAAGAAATAGAGAGATTTGGG + Intronic
1119133621 14:72196592-72196614 ATGAAGAAAAAGCAAGAAAAGGG + Intronic
1120148694 14:81007640-81007662 AGGAGAAAAGAGTAATATTATGG - Intronic
1122109461 14:99486806-99486828 ATGCAGAAAGAGGAAGAGTTAGG - Intronic
1122233305 14:100318112-100318134 AAAAAGAAAGAGGAAGATAAAGG + Intergenic
1123168108 14:106346030-106346052 ATGAGGAAAGAGTAAGATCATGG - Intergenic
1123483784 15:20664471-20664493 TGGCAGAAATAGTAAGATTAAGG - Intergenic
1125057160 15:35374897-35374919 ATGGAAAAACAGTAAGATTAGGG - Intronic
1125848204 15:42878340-42878362 ACGAAGCAAGAGTAAGAATTAGG + Intronic
1126008135 15:44278288-44278310 ATGAAGAAAAAATAAGGCTATGG + Intergenic
1126509645 15:49454582-49454604 ATAAATAAAGAGTATAATTATGG - Intronic
1126885727 15:53147771-53147793 TTGAGGAAAGAGAAAGAGTAAGG + Intergenic
1127836274 15:62793621-62793643 ATGAAGAAACATTCAGAGTATGG - Intronic
1128203109 15:65827159-65827181 ATGAAGAAAGACAGAGATTGCGG - Intronic
1130773016 15:86944055-86944077 CTGAAGGAAGAGTAAGAGTCAGG + Intronic
1131315919 15:91337341-91337363 ATGAAAAAAGAGTCAAATCATGG - Intergenic
1131757717 15:95583763-95583785 ATGGAGAAACAGTGAGATTTGGG + Intergenic
1131937934 15:97527562-97527584 AGGGAGAAAGAGAAAGATTCGGG + Intergenic
1132134295 15:99319346-99319368 TTGAAGAATGAGGAAGATAAAGG + Intronic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1133465986 16:6027491-6027513 TTGAAGAAAGTGAAAGGTTATGG - Intronic
1133492129 16:6280460-6280482 ATGAAGAGTGAAAAAGATTAAGG + Intronic
1135665188 16:24329635-24329657 ATGAAGAAAGTGTCACATTAGGG + Intronic
1135784123 16:25332933-25332955 ATGAAGAATGAGTAAAACTGGGG - Intergenic
1136470684 16:30477998-30478020 AAGAAGAAAAAGAAAGATGAAGG + Intronic
1137285903 16:47015526-47015548 ATGAGCAAAGAGTAGGATAAAGG - Intergenic
1137911496 16:52382637-52382659 ATAAAAAAACAGTAAGATGATGG + Intergenic
1138293860 16:55870323-55870345 AAGAAGAAAGAGGAAGAGGAAGG + Intronic
1138627225 16:58261963-58261985 ATGAAGGAAGAGTAAGAATCAGG - Intronic
1138982353 16:62285083-62285105 ATGATGAAGGAGTTAGATTTTGG + Intergenic
1139272433 16:65696820-65696842 AAGAAGAAAGAGAAAGAAAAGGG + Intergenic
1139338659 16:66251924-66251946 AATAAAAAATAGTAAGATTAAGG - Intergenic
1139698356 16:68691636-68691658 ATGAAGAAAGTTTGAGAATACGG - Intronic
1139908018 16:70380155-70380177 AAGTAGAAAGAGTAAAAATAGGG - Exonic
1140516681 16:75548094-75548116 ATCAAGGATGAGTGAGATTAGGG + Intronic
1140624066 16:76770752-76770774 AAGAAGAAACAGCAAGAATAGGG + Intergenic
1140721846 16:77779253-77779275 ATGAAGCAACGGAAAGATTAAGG + Intergenic
1140791753 16:78398731-78398753 ATTAAGAATTAGAAAGATTAAGG - Intronic
1141120135 16:81347503-81347525 ATCAAGAAAGTGGAAGATTCTGG - Intronic
1141199415 16:81885514-81885536 ATGAAGAAAGGGGAAGGGTAGGG - Intronic
1142832879 17:2562352-2562374 AGGAAGAAAGAGAAAGAGAAAGG + Intergenic
1143364754 17:6399322-6399344 ATCAAGAAAGAGGAAGACTTAGG + Intronic
1144746790 17:17621396-17621418 AAGAAGAAAGAGGAAGAAGAAGG + Intergenic
1145081439 17:19897714-19897736 ATGAAGAAATAGAGAGATGAAGG + Intergenic
1146315038 17:31800166-31800188 ATGAAGACAGAGGAAGAAGATGG - Intergenic
1146438192 17:32871060-32871082 TTGAAGGATGAGTAAGAGTATGG + Intronic
1147110743 17:38259264-38259286 ATAAAGAAATATGAAGATTATGG - Intergenic
1148282979 17:46363266-46363288 AAAAAGAAAGAAAAAGATTAAGG - Intergenic
1148305196 17:46581191-46581213 AAAAAGAAAGAAAAAGATTAAGG - Intergenic
1148418769 17:47529166-47529188 ATAAAGAAATATGAAGATTATGG + Intronic
1148807081 17:50269357-50269379 AAGCAGAAAGAGTAAGAGGAGGG + Intergenic
1149553113 17:57554734-57554756 ATGAAGAAACAGAAGGGTTAAGG + Intronic
1149649538 17:58268290-58268312 AGGAAGAAAGATAAAGGTTAAGG - Exonic
1149745594 17:59094666-59094688 GTGAGGAAAAAGGAAGATTAAGG + Intronic
1151223209 17:72629142-72629164 ATCAAGAAAAAGGAAGATTTGGG + Intergenic
1152271304 17:79326516-79326538 ATAAAGTAAGAATAAGATTATGG - Intronic
1152412539 17:80135513-80135535 GTGAAGAAAGAAACAGATTAAGG + Intronic
1203167935 17_GL000205v2_random:115380-115402 ATGATGAAAAAGAAAGATTGAGG + Intergenic
1153093429 18:1373938-1373960 AAAAAGAAAGAATAAGAGTAAGG + Intergenic
1153463777 18:5366269-5366291 TTTAAGAAATAGTAAAATTATGG + Intergenic
1154087503 18:11321912-11321934 ATGAAGACAGAGAAAGATCCTGG + Intergenic
1155435471 18:25808023-25808045 ACAATCAAAGAGTAAGATTATGG + Intergenic
1155439159 18:25843192-25843214 ATGAGGAAAAAGGAAGAGTAAGG - Intergenic
1155784370 18:29879035-29879057 AAGAGGAAAGAGTAGGATTGGGG - Intergenic
1155906060 18:31452725-31452747 ATGAAGAAACTGAAAGATTAAGG + Intronic
1155916173 18:31559277-31559299 ATGAAGAAAGACAAAGCTTTTGG - Intergenic
1156440811 18:37185836-37185858 ATAAAGAAAAAGTAAGCTGAAGG - Intronic
1156611254 18:38727491-38727513 ATGAAGAGATGGTAAGTTTAGGG - Intergenic
1156621679 18:38858963-38858985 TTCAAGACAGTGTAAGATTAAGG + Intergenic
1156859810 18:41822706-41822728 ATAAAGAAAGAAGAATATTATGG - Intergenic
1157065559 18:44345514-44345536 ATAAAGAAAGAGTAGAATGATGG - Intergenic
1157771908 18:50356397-50356419 GTGAAGAAAGAGAAACATGAGGG - Intergenic
1157957986 18:52120295-52120317 ATGTTGAAAGAGAAAGAATAAGG - Intergenic
1159172177 18:64785099-64785121 ATGAAAAAATAGTAAAAGTAAGG + Intergenic
1159446771 18:68550509-68550531 ATGAAGACAGAGTAGAATGATGG + Intergenic
1159446854 18:68551414-68551436 ATGAAGACAGAGTAGAATGACGG - Intergenic
1159599088 18:70411556-70411578 AAGAAGAAAGAGAAAGATGCTGG - Intergenic
1159924692 18:74257521-74257543 ATGAACAAGGAGAAAGAATATGG + Intronic
1160282339 18:77503048-77503070 ATGAAGAAAGAATTAGTTTAGGG + Intergenic
1162404094 19:10463068-10463090 AAGAAGAAAGAGAAAGAAGAAGG - Intronic
1162907403 19:13831878-13831900 ATGGAAACAGAGTAAGATGAAGG - Exonic
1165088224 19:33366371-33366393 GAGAAGAAAGAGTAACTTTATGG - Intergenic
1165397713 19:35575956-35575978 ATTAAGAAAGAGAAGGAATAGGG - Intergenic
925437429 2:3852197-3852219 ATGAAGAGAAAGAAAGTTTAAGG + Intergenic
925481922 2:4285094-4285116 TTGCAGATAGAGTAAGATTATGG + Intergenic
925716800 2:6791604-6791626 TTGAAGAAAGAGAAAGATACTGG + Intergenic
926808713 2:16737385-16737407 AAGAAGATAGAGTGAGATAATGG + Intergenic
928877173 2:36053535-36053557 ATGAATATACAGTAAGATTTGGG + Intergenic
928893710 2:36237036-36237058 ATGAGGAAAGAGTGTGGTTATGG - Intergenic
929051210 2:37838479-37838501 ATGATGAGAGAGGAAGATTTTGG - Intergenic
929885834 2:45877405-45877427 TAGAAGAAAGAGTAAGAGGATGG - Intronic
929886295 2:45881776-45881798 AATAGTAAAGAGTAAGATTAAGG - Intronic
929904219 2:46032180-46032202 ATGAAGATAAAGTAAGATCATGG - Intronic
930125403 2:47792332-47792354 ATGACGAAAGAGTGTGATTCTGG - Intronic
930416039 2:51092691-51092713 ATCAGGAGAGAGTAAGATTTGGG - Intergenic
930852577 2:55976318-55976340 ATGAAGAAAAAGCCAGATAAGGG + Intergenic
931245298 2:60487525-60487547 ATGAATACAGATTCAGATTAAGG + Intronic
931324814 2:61209343-61209365 ATTAAAAAAGAGTAACATGAAGG + Intronic
931733039 2:65170000-65170022 AAGAAGAAAAAGAAAGATAAAGG + Intergenic
931874998 2:66502841-66502863 AGGAAGAAAGTATAAGAATAAGG - Intronic
931905420 2:66837504-66837526 ATGAAGACAGAGTAGAATGATGG - Intergenic
931917271 2:66969800-66969822 ATGAACAAAGAGGCAGATAAGGG - Intergenic
932107334 2:68956764-68956786 GTGAAGAAAGAGCAAGAGAAAGG - Intergenic
932560910 2:72867878-72867900 AGGAAAAAAGAGTAAAATGAAGG - Intergenic
932891138 2:75598250-75598272 ATGAAGTACAAGTAGGATTATGG + Intergenic
933368914 2:81390443-81390465 ATCAAGAAAAAGTAAGGTGAGGG + Intergenic
933485118 2:82911611-82911633 ATGATGAAAAAGAATGATTATGG - Intergenic
934878956 2:97956075-97956097 ATTAAGGTAGAGTAAGAGTAAGG + Intronic
936292057 2:111233780-111233802 TTGAAGAAAGAGCAAGGTTAAGG - Intergenic
936923313 2:117711223-117711245 CAGAAGAAAGAGGAAGATGAGGG + Intergenic
936963079 2:118097250-118097272 TTGAAGAAAGAACAAAATTAAGG - Intronic
937486206 2:122317488-122317510 ATGAAGAAAAAGGTAGGTTAGGG + Intergenic
937576781 2:123433123-123433145 ATGAAGAAAATGTAAGAAAATGG + Intergenic
938856740 2:135320648-135320670 ATGATGAAACAGGAAGTTTATGG + Intronic
938945067 2:136204937-136204959 ACCAAGAAAGAGAAAGATAAAGG - Intergenic
939071387 2:137548329-137548351 AAGAAGAAACACTAAGATTTAGG - Intronic
939242954 2:139585579-139585601 AGGAAGAAAGAGAAAGAGAAAGG - Intergenic
939247959 2:139649264-139649286 CTGAACAGAGAGTGAGATTAAGG + Intergenic
939256376 2:139749293-139749315 ATGAAGAAAGAATTAGCATAAGG - Intergenic
940031709 2:149270416-149270438 ATGGAGAAAGAATAAAATGATGG + Intergenic
941216902 2:162723169-162723191 ATGAAGAAACAGGTAAATTATGG - Intronic
941613593 2:167693028-167693050 AGGAAGCAAGAGCAACATTAGGG + Intergenic
942242244 2:173973196-173973218 ATGAATTAAGAGTAATATTAAGG - Intergenic
942647227 2:178125764-178125786 GTGAAAAAGGAGTTAGATTAAGG + Intronic
942823609 2:180146386-180146408 ATGAATAAAGATTAAGAATGAGG - Intergenic
943201820 2:184836764-184836786 ATAAAGAGAGATTAAGAATAGGG - Intronic
943202758 2:184850031-184850053 ATGAAGATAGAGTAGAATGATGG + Intronic
943369373 2:186998578-186998600 ATGAAAAAAGAGCAAATTTATGG - Intergenic
943521462 2:188955979-188956001 AAGAAGAAAGAGAAAGAAAAAGG + Intergenic
944141563 2:196462324-196462346 CTAAAGAAAGAATAAAATTAAGG + Intronic
944211825 2:197214026-197214048 ACAAAGAAAGAATAAGATGAAGG + Intronic
944503682 2:200388029-200388051 TTGAAGAAACAGAAGGATTATGG + Intronic
944617557 2:201477553-201477575 ATGAAGAAAGAATAAAAATCTGG - Intronic
944799407 2:203223555-203223577 ATGAAGAAAAATTAGGATTTAGG + Intronic
944828472 2:203508687-203508709 ATTAAGAAAGAGAGAGATGAAGG + Intronic
945472610 2:210244913-210244935 ATGGTGAAAGAGAAAGGTTAAGG + Intergenic
945560774 2:211337319-211337341 ATGAAGAAAGATTATGTATAAGG - Intergenic
945918337 2:215728497-215728519 ATGAAGAAAGGATAAAATGATGG + Intergenic
946912756 2:224482696-224482718 ATGAATAAAGTGTAATACTAGGG + Intronic
947042293 2:225936962-225936984 ATGAAGAGACAGTAAGTTCAAGG - Intergenic
947703088 2:232251953-232251975 ATGAAGAAAGAGGAAGACATGGG + Intronic
947848982 2:233269001-233269023 AAGAAGAGAGAGTAAGGTCAGGG + Intronic
948280030 2:236739984-236740006 ATGAAGAAAGAGTTTTTTTATGG - Intergenic
1169784458 20:9344151-9344173 AGGAGGAAAGAGAGAGATTAAGG - Intronic
1169937814 20:10903808-10903830 ATGAAGTAAGAGCAAAAATAGGG - Intergenic
1170203615 20:13772563-13772585 ATGAAGGAAGAGCAAGTTCAAGG - Exonic
1170776423 20:19378711-19378733 ATGAAGAAAGACTGAGCTTTGGG - Intronic
1172384489 20:34524199-34524221 ATGAAAAAAGAGCCACATTAAGG - Intronic
1173339404 20:42140108-42140130 AGGAAGAAAGAGTAAGATACAGG - Intronic
1174763529 20:53229947-53229969 AGGAAGAAAGAGAAAGAAGAAGG + Intronic
1176007948 20:62876360-62876382 ATGCAGAGAGAAAAAGATTAAGG + Intergenic
1176403822 21:6343756-6343778 ATGATGAAAAAGAAAGATTGAGG - Intergenic
1176433335 21:6645348-6645370 ATGATGAAAAAGAAAGATTGAGG + Intergenic
1177161895 21:17556833-17556855 ACTAAGAAAGAGTAAGGTCATGG + Intronic
1177343624 21:19838353-19838375 TTGAAAAAAGAGAAAGATTAAGG - Intergenic
1178967202 21:37132044-37132066 TTGAAAAAAGAGAAAAATTAAGG - Intronic
1180412024 22:12622093-12622115 TAAAACAAAGAGTAAGATTAGGG - Intergenic
1180692073 22:17725420-17725442 CTGAAGAATGGGTAAGATTTTGG - Intronic
1181372870 22:22431920-22431942 ATGAAGAAAGGGAGAGATTTGGG + Intergenic
1182819729 22:33205117-33205139 TTAAAGAAAGAGTATGATTTTGG - Intronic
1182887416 22:33787037-33787059 AGAAAGAAAAAGTAAGATAATGG + Intronic
1184014795 22:41777902-41777924 AAGAAGAAAGAAGAAGATGAAGG - Intronic
1184377774 22:44125356-44125378 GTGAAGAAAGAGAAGTATTATGG + Intronic
1184928400 22:47660741-47660763 ATGAAGAAGGAGGAAGAGGAGGG - Intergenic
949127235 3:460841-460863 AGGAAGGTAGAGTGAGATTAGGG + Intergenic
949310444 3:2691390-2691412 AAGAAGAAAGAGGAAGAGGAGGG + Intronic
949373121 3:3356599-3356621 ATGAAGAAATAGTAACAGTAGGG + Intergenic
949560207 3:5194367-5194389 ATGAAGAACTAGTAAAATAAAGG - Intronic
950288540 3:11764473-11764495 AAAAAAAAAGAATAAGATTATGG - Intergenic
950407680 3:12814914-12814936 ATGAAGCTAAAATAAGATTATGG + Intronic
951048532 3:18068163-18068185 TTGAAGGAGGAGTAGGATTATGG - Intronic
951899174 3:27640209-27640231 AAGAAGAAATATTTAGATTATGG + Intergenic
951984892 3:28608043-28608065 ATGGTGAAAGAGTAAGACTTAGG + Intergenic
952116837 3:30192440-30192462 ATGAATTTAAAGTAAGATTATGG - Intergenic
952224235 3:31357892-31357914 AAGAACAAAGAGTGAGTTTATGG - Intergenic
952791368 3:37203238-37203260 GTGGAGAAAGCGTGAGATTATGG - Intergenic
952794579 3:37227540-37227562 ATGCAGAAACAGGAAGTTTAAGG - Intergenic
953012165 3:39037289-39037311 ATGGAGATAGAGTAAAATGATGG + Intergenic
953163823 3:40446331-40446353 ATGAGGAAAGAGAAAGGATAGGG + Intergenic
953419702 3:42744951-42744973 ATGAAGACATAGGAAGATGAAGG + Intronic
954269861 3:49499473-49499495 ATGAGGAAACATTAAGTTTATGG + Intronic
956013133 3:64852900-64852922 AATAACAAAGAGTGAGATTAGGG - Intergenic
956055294 3:65292185-65292207 ATGAAGCAAAAGTAATAGTATGG - Intergenic
956137137 3:66110572-66110594 ATGAAGAGAGAGAAAGAGAAAGG + Intergenic
956526385 3:70167086-70167108 ATGAGGAAAGAATAATATTTTGG - Intergenic
957037897 3:75311987-75312009 CTGAAGGCAGAGTAGGATTAGGG - Intergenic
957555201 3:81757972-81757994 ATGAAAGAAAAGCAAGATTATGG + Intronic
957636528 3:82791865-82791887 ATGCAGAATAAGTTAGATTAAGG + Intergenic
957862754 3:85977656-85977678 ATGAAGAAAGATTATGTATATGG - Intronic
958023031 3:88018752-88018774 ATGAAGAAAGAGTTAAATTTAGG + Intergenic
958065184 3:88535882-88535904 ATGAAAAAATAATAAAATTAAGG - Intergenic
958487786 3:94733559-94733581 AAGAAGAAAGAGGAAGCTAAAGG + Intergenic
959253361 3:103976806-103976828 TTGAAAATAGAGTAGGATTAAGG + Intergenic
959261617 3:104089363-104089385 ATGAAGTTAGATTATGATTAGGG - Intergenic
959637393 3:108590302-108590324 ATGTAGAAATTGTAAGAATAGGG + Intronic
960480919 3:118189181-118189203 ATGAAGAGGGAGTAATATGAAGG + Intergenic
960631051 3:119730706-119730728 ATGAAGAAAGGGTAAGAAACAGG - Intronic
962082934 3:132159760-132159782 GGGAAGAAACAGAAAGATTAGGG + Intronic
962841067 3:139233017-139233039 ATGAAGAAAGAAGGAGAATATGG + Intronic
963137051 3:141916162-141916184 ATTAAGGAAGAGAAAGACTACGG - Intronic
963961987 3:151319865-151319887 TTGAAAAATCAGTAAGATTACGG - Intronic
964226028 3:154403268-154403290 ATTAAGAAAGAGTAAATTAAAGG + Intronic
964715078 3:159713164-159713186 AAGAAGAAAGAGAAAGAAAAAGG + Intronic
964771824 3:160232109-160232131 ATGAAGAAAGAATATGCTTGAGG - Intronic
964926693 3:161967378-161967400 ATGGAGAAAGTGAAAGTTTATGG + Intergenic
965043947 3:163551167-163551189 ATGTAGAAAGAGAAAAATGAAGG - Intergenic
965141391 3:164840408-164840430 ATTAAGAAACAGAGAGATTAAGG + Intergenic
965552519 3:169982771-169982793 ATAAAGAAAGAAAAAGATAAAGG + Exonic
966111623 3:176409053-176409075 AAGAAGAAAGATGAAGAGTAGGG + Intergenic
966250132 3:177856412-177856434 ATAAAGAAATAGTAATAGTAAGG + Intergenic
966290440 3:178349947-178349969 ATGAAGCAAAATTAACATTATGG + Intergenic
966313343 3:178618419-178618441 GTGAAGACAGAGAAGGATTAGGG - Intronic
966480675 3:180404874-180404896 AGGAGGAAAGAGAAAAATTAAGG + Intergenic
966985629 3:185177869-185177891 ATGAAGAAAATGCAAGATCAAGG + Intergenic
967026322 3:185567822-185567844 ATCAAGAAAGAGAAGGAATAGGG - Intergenic
967503984 3:190232337-190232359 GTTAAGAAAGAGAAAGATGAAGG - Intergenic
970356415 4:15258059-15258081 AAGAAGAAAAAGAAAGATTTAGG - Intergenic
970678951 4:18485226-18485248 ATAAAGAAAAAGTAAGAATAAGG + Intergenic
971226825 4:24761825-24761847 CTGAAGAAGGAGAAAGATAAAGG + Intergenic
971733311 4:30414338-30414360 ATGAAGAAATTGTAAGATTAGGG + Intergenic
971845975 4:31917891-31917913 ATGAAGCAAATGTTAGATTAGGG + Intergenic
972020397 4:34306191-34306213 ATGACGCAAGAGAGAGATTAGGG + Intergenic
972076031 4:35088178-35088200 ATAAAGAAAGAATGAGAATAGGG + Intergenic
972144429 4:36003852-36003874 TTGAAGAAAAAATAAGATTATGG + Intronic
974136922 4:57830071-57830093 AGGAAGAAAGAGAAAGAGGAAGG + Intergenic
974361275 4:60883459-60883481 ATGAGACAAGGGTAAGATTACGG - Intergenic
974490620 4:62558872-62558894 AGGAAGAAAAAGGAAGATCAGGG + Intergenic
974629661 4:64469240-64469262 ATGAAAATAGTGAAAGATTAGGG - Intergenic
974700602 4:65440426-65440448 ATACAGAAATAGTGAGATTAAGG + Intronic
975043827 4:69777538-69777560 ATGGAGAAAGAGGAAGACGATGG + Intronic
975091022 4:70404371-70404393 ATGGAGAAAGGGTAAGAAGATGG - Intronic
975603571 4:76128925-76128947 GTGGAGAAAGAGTAGGAGTAGGG + Intronic
976383547 4:84428563-84428585 ATGAATAAAGCATAAGTTTAAGG - Intergenic
976728872 4:88243014-88243036 ATGAAGAAATAACAAGATAAAGG - Intergenic
977039454 4:91997282-91997304 ATGAAGAAGGCGTAAGATGGGGG + Intergenic
977415484 4:96727548-96727570 AAGAAGGAAGAGTAAGAGGAGGG + Intergenic
977659344 4:99564500-99564522 ATGAATAAAGAGTAAAGCTATGG - Intronic
977797620 4:101186078-101186100 ATGAAGAAATTGTAAGTTAAAGG - Intronic
978703130 4:111673492-111673514 AAGAAAAAAGAGTAAGTTAATGG + Intergenic
978751915 4:112259383-112259405 ACGAAGACAGATTAAGAGTATGG - Intronic
978818955 4:112943080-112943102 AGAAAGAAAAAGAAAGATTAAGG - Intronic
979021886 4:115512195-115512217 AGTAAGAAGGAGTAAGATTTAGG - Intergenic
979055871 4:115993179-115993201 ATGAACAAAGACTAATTTTATGG + Intergenic
979202552 4:117995884-117995906 ATGGAGAAGGAGTAAAATTTGGG - Intergenic
979589127 4:122458189-122458211 ATGAAGAAAAGGTCAGATTAGGG + Intergenic
979640685 4:123010240-123010262 ATGAAGAATGAGTAGGAGTTAGG - Intronic
979718688 4:123872318-123872340 ATGAAGAAAGTGGCAGGTTAAGG - Intergenic
979983464 4:127286373-127286395 ATATAGAAAGAATAAGATTGAGG - Intergenic
980482848 4:133411050-133411072 ATGAAGAAAGAAGCAGATAAAGG - Intergenic
981030513 4:140120680-140120702 ATGAGGAAAAAAAAAGATTAAGG - Intronic
981419934 4:144537833-144537855 TTTAAGAAAGAGTAATATTATGG - Intergenic
981559948 4:146036915-146036937 ATGAATAAATTGTGAGATTATGG + Intergenic
981571435 4:146155193-146155215 ATGAAGTAAGATTAAACTTATGG - Intergenic
981723171 4:147821718-147821740 ATGAAGACTGAGTCATATTATGG - Intronic
981844276 4:149149554-149149576 AAGAAGAAAGAACAAGATCATGG - Intergenic
981959845 4:150523367-150523389 ATGGAGAAAGGGTAAGATAGTGG - Intronic
982035973 4:151346024-151346046 ATGAAGAAGGAATAAAATAAGGG - Intergenic
983207024 4:164921108-164921130 ATGAATTAAGAGTAAGAACATGG - Intergenic
983395383 4:167187318-167187340 AGGAAGAAAGAGTACAATGAGGG - Intronic
983994522 4:174165514-174165536 ATGAAGCAAGAGAAATATTGGGG - Intergenic
984342478 4:178475078-178475100 ATGAGGAAAGAAAAAGAATAAGG + Intergenic
984563602 4:181300888-181300910 ATGAAGAAAAGGTAAGGTCAAGG - Intergenic
984633428 4:182085073-182085095 ATAAAGAAAGAGGAAGAGGAAGG + Intergenic
985017089 4:185647721-185647743 ATGAAGACTGAGAAAGTTTAAGG - Intronic
986374085 5:7112416-7112438 ATGATAAAAGAGTAAGAAAAAGG - Intergenic
987028206 5:13949718-13949740 ATGTAGAAAGTGTAAGAATTAGG + Intergenic
987824601 5:23012860-23012882 ATAAAGAAAAAAAAAGATTATGG - Intergenic
988000914 5:25347167-25347189 AGGAAGAAAGAGAATGATGAAGG - Intergenic
988368676 5:30337718-30337740 ATGATGAAAAAATAAGATGAAGG + Intergenic
988452622 5:31358670-31358692 AGGAAGAAAGAGAAAGAAGATGG - Intergenic
989246020 5:39255661-39255683 ATGTAGAAAGAGTCAGGATAAGG - Intronic
989291046 5:39766347-39766369 ATGAAAAAAGAAAAGGATTAAGG - Intergenic
989314971 5:40067802-40067824 ATGAAGCAGAAGTAAAATTAAGG - Intergenic
989465718 5:41752871-41752893 AAGGAGAAAGAGAAAGATTAGGG - Intronic
990062471 5:51669234-51669256 ATCCAGAAAGAATAAGAATAGGG - Intergenic
990153057 5:52842305-52842327 ATGAAGAAAATCTAAGATGAGGG - Intronic
990286653 5:54307026-54307048 GAGAAGAAAGAGTAAGATGCTGG + Intronic
990439779 5:55832881-55832903 TTGAAGAAAGAGAAAGAGAATGG + Intergenic
990534496 5:56706694-56706716 CTCAAGAAAAAGGAAGATTATGG + Intergenic
990650718 5:57896508-57896530 ATGAAGAAAGAATAAATTTCAGG - Intergenic
990661635 5:58022040-58022062 ATGAAAAAAGAGTCAGAATTGGG - Intergenic
990769688 5:59229031-59229053 ATGGAGAAAAATTAAGAGTAAGG - Intronic
991160501 5:63493794-63493816 AAAAAGAAAGAGTAAGCATAAGG - Intergenic
991583306 5:68178530-68178552 ATGCAGAGAGAGTAAGAATAAGG - Intergenic
993088306 5:83392391-83392413 ATGAAGAAAGAGTAAAAAGTAGG - Intergenic
993506182 5:88711540-88711562 ATTGAGCAAGAGTAAGAGTATGG + Intergenic
993590336 5:89787596-89787618 AGTAAGAAAGAGTCATATTAAGG + Intergenic
994312183 5:98286427-98286449 AAGAAGAAATAGCAATATTAGGG + Intergenic
994326842 5:98457593-98457615 GTGAATAAAGAGAGAGATTAGGG - Intergenic
994343477 5:98659678-98659700 ATGATGAAAGAAAAAGATTGGGG + Intergenic
994638130 5:102368257-102368279 ATAAAGGAACAGTAAGAATATGG - Intergenic
994972094 5:106753877-106753899 ATGTAGAAAGATGAAGATTCAGG + Intergenic
995033058 5:107500996-107501018 ATGAATAAATAGTAAGAGTTAGG - Intronic
995096098 5:108237454-108237476 TTGAAGAGAGAACAAGATTATGG + Intronic
995121917 5:108545414-108545436 GTCAAGAAAGAGTCAGATCATGG - Intergenic
996206768 5:120747741-120747763 AGGAAGGAAGAGAAAGATGAAGG + Intergenic
996764852 5:127025760-127025782 AAGAAGAAAGAAAAAGATGAAGG - Intronic
997750104 5:136336113-136336135 TTGAAGAATGAGTAAGAGTTTGG - Intronic
997803163 5:136887456-136887478 AAGTAGAAAGAGTAACTTTAAGG - Intergenic
998019541 5:138757847-138757869 ATGAGGCAACAGTCAGATTATGG + Intronic
998676963 5:144420298-144420320 AAGAGGAAAGAGGCAGATTATGG + Intronic
999018001 5:148129513-148129535 ATGAAGAGAGAGAGAGAGTAAGG + Intronic
999477715 5:151916522-151916544 ATGGAGAAAAAGGAAGATCATGG + Intronic
999653855 5:153794021-153794043 AAGAGGACAGAGTCAGATTAAGG - Intronic
999950279 5:156642083-156642105 GTGAAGATACAGTAAGATGATGG - Intronic
999952165 5:156662980-156663002 ATCAAGAAAGAGAAGGAATAGGG - Intronic
1000101924 5:158024553-158024575 AAGAAGGAAGATAAAGATTACGG + Intergenic
1000762283 5:165241276-165241298 AAGAAGAAAGAGAAAGAAAAGGG + Intergenic
1000876472 5:166645123-166645145 ATGGAAAAAGATTAAGATTTGGG - Intergenic
1002826397 6:777944-777966 ATGAAGACACAGGAAGATGAAGG + Intergenic
1003017314 6:2478489-2478511 AGGGAGAAAGAGAAAGATGAAGG - Intergenic
1006306644 6:33225241-33225263 ATGAATAAATAGAGAGATTATGG + Intergenic
1008203347 6:48620129-48620151 ATAAAGAAAGTTTAAAATTAAGG + Intergenic
1008584933 6:52940021-52940043 AATAAGAAAGAGTAAAATCAGGG + Intergenic
1008653064 6:53583253-53583275 ATGGAGAAATAGTAAGAGTAAGG - Intronic
1008737945 6:54569970-54569992 ATGCAGAATGAGTGAGGTTAAGG - Intergenic
1008768570 6:54950550-54950572 ATGAAATTAGAGTAACATTAGGG + Intergenic
1009559681 6:65222924-65222946 ATGAAGAAGAAGTAAGAGTCAGG + Intronic
1010404585 6:75488894-75488916 AAGAAGAATGAATAGGATTAAGG + Intronic
1010415711 6:75609227-75609249 AAGAGGTAAGAGTAAGAATAGGG - Intronic
1010976695 6:82323643-82323665 ATCAAGAAAGAGGAAGATGTGGG - Intergenic
1011049641 6:83130635-83130657 ATAAAGAAAGAGAAGTATTAGGG + Intronic
1011180569 6:84615202-84615224 ATGAAGAAAGAGAAAGATTAGGG - Intergenic
1011445216 6:87432133-87432155 ATGAAGAAAGAAGAAAAATAAGG - Intronic
1011856003 6:91692255-91692277 AGGAATTAAGAGTAAGAATAAGG + Intergenic
1013205915 6:107945773-107945795 CTGAATAAAAAGTATGATTAAGG + Intronic
1013328100 6:109068529-109068551 ATGAAAAAAGGTTAAGATGAAGG + Intronic
1013859078 6:114611998-114612020 AGGAAGAAAGAGAAAGAAGAAGG - Intergenic
1014189638 6:118479268-118479290 AAGAAGTAACAGTAAAATTAGGG + Intronic
1014683184 6:124459680-124459702 ATGAAGCAATATTAACATTAGGG - Intronic
1014825439 6:126044775-126044797 AAGAAGAAATATTAAGCTTAGGG - Intergenic
1015231139 6:130916283-130916305 GCAAATAAAGAGTAAGATTAAGG - Intronic
1015643058 6:135357564-135357586 AAGAAATAAGAGTAGGATTAGGG + Intronic
1016097271 6:140053700-140053722 ATAAAGAAGGATTAAGACTAAGG - Intergenic
1016497803 6:144683953-144683975 ATGATGAAAGATTAGGATAATGG - Intronic
1017479217 6:154832929-154832951 ATGAAGAAAGAGGTAGATTTCGG + Exonic
1017531692 6:155299141-155299163 ATCAACAAATATTAAGATTAGGG - Intronic
1017694026 6:156996126-156996148 ATTAAGAAAAATTAAGATTTTGG - Intronic
1017906919 6:158763057-158763079 AGGAGGAAAGATTAAGATGAGGG + Intronic
1018151359 6:160942830-160942852 ATGAAGAAATAGCAAGAGAATGG - Intergenic
1019939120 7:4275288-4275310 AAGAAGAAAAAGAAAGATGAGGG + Intergenic
1019976620 7:4587992-4588014 ATCAAGAAAGAGAAGGAATAGGG - Intergenic
1019977556 7:4596496-4596518 ATCAAGAAAGAGAAGGAATAGGG - Intergenic
1021579158 7:22133858-22133880 AATAAGAAAGAGGAAGATTGAGG + Intronic
1023206790 7:37759444-37759466 AGGAGGAAAGAGTAAAATAATGG - Intronic
1023407175 7:39846656-39846678 ATAAACAAAGAGTAACATTAAGG - Intergenic
1023563934 7:41504940-41504962 ATGATGAAAGAGGAAGCTGATGG - Intergenic
1023584391 7:41714244-41714266 AGGAAGAAAGAGAAAGAGGAGGG + Intergenic
1024508110 7:50180206-50180228 AAGACGAATGAGTAAAATTAAGG - Intergenic
1024600456 7:50975916-50975938 AGGAAGAAAGAGGAAGATTTGGG + Intergenic
1024754113 7:52508022-52508044 ATGAGGAAAAAATAAGAGTAAGG + Intergenic
1024935780 7:54710763-54710785 ATGAATAAAGAGTACTTTTATGG - Intergenic
1026175460 7:67992618-67992640 ATGAAGAAAGAGGAACATCGCGG - Intergenic
1026213962 7:68331807-68331829 ATGCAGAAAGAGAAAGCTGAGGG + Intergenic
1026371613 7:69705345-69705367 ATGAAGAAAAATTAAGATCTGGG - Intronic
1026376542 7:69756933-69756955 ATGAAGAAAAAGCAAAATAAAGG - Intronic
1027546800 7:79537255-79537277 ATGAAGAAATAGTCAGTATAAGG + Intergenic
1028841972 7:95438265-95438287 ATTCAGAAAGAGAAAGAATATGG - Intergenic
1029179169 7:98687467-98687489 AAGAAGAAAGGACAAGATTAGGG - Intergenic
1029966912 7:104749883-104749905 ATCAAGAAAGAGAAGGAATAGGG - Intronic
1030333931 7:108303331-108303353 ATGAAGAATGAGGAAGAGCAAGG - Intronic
1030360260 7:108588061-108588083 ATAAAAACAGAGTAAGATAAAGG - Intergenic
1030881626 7:114887733-114887755 ATGAAGAAAGAGTCAGGACAGGG - Intergenic
1031243371 7:119274134-119274156 TTGAAGATAGATTAATATTAAGG - Intergenic
1031552645 7:123133828-123133850 ATGAATAAAAATAAAGATTAGGG - Intronic
1031560951 7:123237518-123237540 ATGAAGAATGAGTAGGCTTTAGG + Intergenic
1031633655 7:124075233-124075255 GTGCAGAAAGAGTAAGAGAAAGG - Intergenic
1031636831 7:124110880-124110902 ATCATGAAAGAGCAAGACTAAGG + Intergenic
1032686048 7:134234852-134234874 ATCAAATAAGAGTAAGATTTAGG - Intronic
1033014526 7:137659032-137659054 ATGAAGAAAAATTTAGAATATGG - Intronic
1033907469 7:146223006-146223028 ATGAAACAATAGTAAGATCAGGG + Intronic
1035890076 8:3333602-3333624 TTCAATAAAGATTAAGATTATGG - Intronic
1036597700 8:10228875-10228897 ATGAAGAAAAAGGAAGTTAAGGG - Intronic
1037135659 8:15456532-15456554 ATTAATAAAGAGTGATATTAGGG + Intronic
1037341041 8:17845450-17845472 ATGAAGAAACAGTCAGATAGAGG - Intergenic
1037421505 8:18708170-18708192 AGGAAGAAAGAGTAAGTCTGAGG - Intronic
1037895566 8:22651456-22651478 ATGAAGAAAGAGGAGGATCAGGG - Intronic
1038207454 8:25480568-25480590 ATGAGGAAAGAGAAAGTTGATGG + Intronic
1038839291 8:31165819-31165841 ATGATGAAATAGTAAAATTGGGG + Intronic
1039196389 8:35036219-35036241 CTGGAGAAAGAGTCACATTAAGG + Intergenic
1039219888 8:35318698-35318720 ATAAAGAAAGTGTAATATAATGG - Intronic
1039395137 8:37219360-37219382 ATGCAGAAAGAGTTAAATTCTGG + Intergenic
1040085951 8:43341671-43341693 AAACAGAAAGAGTAACATTAAGG - Intergenic
1040406699 8:47111387-47111409 AAACAGAAAGAGTAACATTAAGG + Intergenic
1040579188 8:48682340-48682362 ATGAAGGAAGAGTACGTTTCTGG - Intergenic
1040671216 8:49692685-49692707 TTGAAGAAATATTAAGATGATGG - Intergenic
1041406191 8:57501868-57501890 ATGAAGACAGAGTAAGAGATGGG + Intergenic
1042396285 8:68295086-68295108 ATGCAGATATAGTAAGGTTATGG - Intergenic
1042460200 8:69056686-69056708 ATGTTGAAATAGTGAGATTATGG - Intergenic
1042628111 8:70782522-70782544 AAGCAGAAGGAATAAGATTATGG - Intronic
1042770638 8:72377356-72377378 TTGAATAAAGAATAAAATTAGGG + Intergenic
1042876507 8:73445165-73445187 ATGGAGACAGAATAAGATTCTGG - Intronic
1043746739 8:83882263-83882285 ATAAATAAAGAGTGAGAATAAGG + Intergenic
1044066100 8:87702427-87702449 ATGAAGATACAGTAAAATTATGG + Intergenic
1045135544 8:99212938-99212960 CTAAAGAAAGAATAAGATTTTGG - Intronic
1045403464 8:101841895-101841917 ATAAAGAAAAAGAAAGAATACGG + Intronic
1046118024 8:109807872-109807894 ATTAACAAAGAGTAAATTTATGG - Intergenic
1046293129 8:112188379-112188401 TTCAAGAAATAGTAAGATGAGGG + Intergenic
1046847949 8:118939645-118939667 ATGAAGAAAGAGAAGGAATTTGG + Intronic
1047020598 8:120771409-120771431 ATGAAGAAAAAGACAGATTTAGG + Intronic
1047120998 8:121905014-121905036 ATGGACATTGAGTAAGATTAGGG - Intergenic
1047155826 8:122317019-122317041 ATAAAGAAAGAGAAAGGTCATGG + Intergenic
1047791123 8:128205010-128205032 ATGAAGAAAGAGGAAGTAGAAGG + Intergenic
1047936472 8:129785352-129785374 ATGGAGATAGAGTAAAATGATGG + Intronic
1048436284 8:134421383-134421405 ATGAAGAAAGAATAAGCAGAGGG + Intergenic
1049903874 9:197526-197548 AGGGAGATAGAGTAAGATGATGG - Intergenic
1050136567 9:2472047-2472069 ATGAAGAAAGAGAATAATCAGGG - Intergenic
1050260947 9:3840577-3840599 ACTAAGAAAGAGGAAGATAATGG + Intronic
1050294583 9:4192844-4192866 ATAAAGAAAGAGAAAAATAAAGG + Intronic
1050658701 9:7858802-7858824 ATAAAGAAACAGTGTGATTAGGG + Intronic
1050938591 9:11429123-11429145 AGGAAGAAAGACAAAGATAAAGG + Intergenic
1051100608 9:13516729-13516751 GTGAAGCAAGAGTAGAATTAGGG + Intergenic
1051136180 9:13924328-13924350 AGGAAGAAAGATTAACATTAAGG + Intergenic
1051472069 9:17455372-17455394 ATGAAGAAATACTGAAATTATGG - Intronic
1051522813 9:18009218-18009240 AAGAAGAAATAGGAAGATGAAGG - Intergenic
1052138981 9:24954478-24954500 ATGAATAAAGATTCAGATTCTGG - Intergenic
1052167423 9:25350018-25350040 ATTTTGAAAGAGTAAGATTTGGG - Intergenic
1052629977 9:31025326-31025348 ATGAAGAAAGAGAAAGTAGAGGG + Intergenic
1053008025 9:34616942-34616964 ATGCAGGAAGGGAAAGATTAGGG + Intronic
1053367042 9:37530278-37530300 ATCTGGAAAGAGTAAGAATAAGG - Intronic
1053667570 9:40326879-40326901 CAGAGGAAAGAGTAAAATTAAGG - Intronic
1053917153 9:42951982-42952004 CAGAGGAAAGAGTAAAATTAAGG - Intergenic
1054378713 9:64466906-64466928 CAGAGGAAAGAGTAAAATTAAGG - Intergenic
1054517041 9:66049406-66049428 CAGAGGAAAGAGTAAAATTAAGG + Intergenic
1055465326 9:76559719-76559741 ATGAAGACAGAGGAGGAATAAGG - Intergenic
1055633284 9:78246878-78246900 ATTACAAAAGTGTAAGATTAGGG - Intronic
1055716779 9:79126554-79126576 ATGAAGACAGAGCAAGAAAATGG + Intergenic
1055723558 9:79202550-79202572 ATGGATAAAGATTAAGATGATGG + Intergenic
1057226660 9:93296452-93296474 ATGAAGAAGGAGGAAGGTAAGGG - Intronic
1057453326 9:95185449-95185471 ATGAAGACAGTCTAAGCTTAGGG + Intronic
1057474928 9:95390684-95390706 ATGAAGACAGTCTAAGCTTAGGG - Intergenic
1058135753 9:101305960-101305982 ATAAAGAAAGAGGATGATGAAGG - Intronic
1058423137 9:104852546-104852568 ATGAAGAAATAGTATAACTAAGG + Intronic
1058438596 9:104987204-104987226 AGGAAGAGAGAGAAAGATTAAGG - Intergenic
1059060602 9:111032088-111032110 TGGAAGAAAGAGTAATATAAAGG + Intronic
1059545267 9:115169408-115169430 ATGAAAAAACTGTAAGATTTTGG + Intronic
1059742631 9:117167426-117167448 ATGAAGAGAGAAGAAGATAATGG - Intronic
1060862979 9:126971116-126971138 ATGAAGAAAGAATAAGACTTTGG + Intronic
1203428077 Un_GL000195v1:59980-60002 ATGATGAAAAAGAAAGATTGAGG + Intergenic
1203438201 Un_GL000195v1:163322-163344 ATGATGAAAAAGAAAGATTGAGG - Intergenic
1185772203 X:2773352-2773374 AGGAAGAAAGAAAAAGAATAAGG + Intronic
1185992653 X:4909519-4909541 AGGAAGAAAGAGAAAGAAGAAGG - Intergenic
1186234296 X:7490900-7490922 ATGAAGACAGAGGAAGAATGTGG + Intergenic
1187261014 X:17685340-17685362 ATGGAGAAAGAAAAAGATTTTGG + Intronic
1188558347 X:31438105-31438127 AGGCAGAAAGAGGAAGATAAAGG - Intronic
1188593279 X:31865110-31865132 AAAAAGTAAGAGGAAGATTATGG + Intronic
1188643981 X:32541335-32541357 ATGAAGATGGAGGAAGATTGTGG - Intronic
1188741026 X:33781784-33781806 AAAAGGAAAAAGTAAGATTAAGG + Intergenic
1188773120 X:34178880-34178902 ATGAAGAAAGAGAAAAATTACGG - Intergenic
1189850835 X:45174564-45174586 TTGAAGAATGAGTAGGATTTTGG + Intronic
1190813069 X:53903665-53903687 ATGAAAAAAGAAGAATATTAGGG + Intergenic
1190858567 X:54321237-54321259 AAGAATAAAGAGTAACATAATGG - Intronic
1191807457 X:65150019-65150041 ATGAAGAAAGAATATGCTCATGG - Intergenic
1191847944 X:65562697-65562719 AAGAAGAAAGAGTATGAACATGG - Intergenic
1192112193 X:68376477-68376499 ATAAAGAAAGAGAAAGATCATGG + Intronic
1192672219 X:73157700-73157722 ATTAAGAAAGAGTTATAATATGG - Intergenic
1193896701 X:87122985-87123007 ATCAAGAAAAGGTAAAATTATGG + Intergenic
1194005245 X:88483830-88483852 AAGAAGAAGGAGTAAGTTTTAGG - Intergenic
1195252964 X:103065700-103065722 AAGAAGAAATAGTAGTATTAAGG - Intergenic
1195585716 X:106563431-106563453 ATGAAGTAAGAGAACCATTAGGG + Intergenic
1195693827 X:107651878-107651900 ATGAAGAAAGAGAGAGCTAAAGG - Intergenic
1195811571 X:108838254-108838276 AAGAAGAAATAATAAGATGATGG - Intergenic
1195815497 X:108881151-108881173 AGGAAGAAAGAATAAGTGTAAGG + Intergenic
1196106251 X:111899037-111899059 AATAAGAAAGAGTAAGAGTGTGG - Intronic
1196295652 X:113993917-113993939 AGGAAGAAAGAGAAAGAAAATGG - Intergenic
1196296634 X:114004789-114004811 ATTCAGAAAAAGTAAGATAAGGG - Intergenic
1196694815 X:118600423-118600445 AAGAAAAAAGAAAAAGATTAGGG + Intronic
1197518548 X:127468806-127468828 ATGAAGGAAGAATAATGTTATGG - Intergenic
1198317653 X:135485333-135485355 GTGAAGAAAGACGAGGATTAGGG + Intergenic
1198662440 X:138984425-138984447 AAGAAGAAAGAAGAAGAATAAGG + Intronic
1199297191 X:146172694-146172716 ATGCAGAAAGAGGAAAGTTAGGG - Intergenic
1199510038 X:148611590-148611612 CTGAAGAAAGAGCAATTTTAAGG - Intronic
1199693034 X:150323446-150323468 AGGAAGAAAGAATAAAAATATGG + Intergenic
1199838090 X:151613943-151613965 ATGAAGTTATAGTAAGAATAAGG - Intronic
1202282607 Y:23205862-23205884 ATGTAGAAAGAATAAAACTAAGG - Intergenic
1202283284 Y:23212657-23212679 ATGTAGAAAGAATAAAACTAAGG + Intergenic
1202434281 Y:24820247-24820269 ATGTAGAAAGAATAAAACTAAGG - Intergenic
1202434958 Y:24827043-24827065 ATGTAGAAAGAATAAAACTAAGG + Intergenic
1202593618 Y:26513204-26513226 ATGCAGAAAGATTGAGATTCGGG + Intergenic