ID: 906983366

View in Genome Browser
Species Human (GRCh38)
Location 1:50655943-50655965
Sequence GGTTTTATTGAAGGGCAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906983354_906983366 26 Left 906983354 1:50655894-50655916 CCAAAAACATATATTTCAAGTTT 0: 1
1: 1
2: 5
3: 90
4: 1145
Right 906983366 1:50655943-50655965 GGTTTTATTGAAGGGCAAGGGGG 0: 1
1: 0
2: 0
3: 31
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906983366 Original CRISPR GGTTTTATTGAAGGGCAAGG GGG Intronic
901667025 1:10831842-10831864 GGTTTAATGGGAGCGCAAGGGGG - Intergenic
901855907 1:12043715-12043737 GGTTTTGTGGAATGGAAAGGGGG + Intergenic
903519523 1:23936026-23936048 GGTTTTGTGGAATGGAAAGGGGG + Intergenic
905891905 1:41523147-41523169 GATTTTATGGAAGAGCAAGACGG - Intronic
906136342 1:43502501-43502523 GGTTTTGTGGAATGGAAAGGGGG + Intergenic
906811290 1:48829582-48829604 GGTTATATTCAAGGGTGAGGAGG - Intronic
906848925 1:49226615-49226637 AGTATTATTGAAGGACAAGCAGG - Intronic
906983366 1:50655943-50655965 GGTTTTATTGAAGGGCAAGGGGG + Intronic
907313149 1:53551418-53551440 GGGATAATTGCAGGGCAAGGGGG + Intronic
910264153 1:85320925-85320947 GGTTTTACCCAAGGTCAAGGTGG + Exonic
914467946 1:147949214-147949236 GGTTTTGTGGAATGGAAAGGGGG - Intronic
916413511 1:164571297-164571319 GGTTTTTTTAGGGGGCAAGGAGG - Intronic
917017913 1:170555381-170555403 GTTTTTATTTAAGTGCAATGAGG - Intergenic
917888994 1:179418443-179418465 GGTTTTGTGGAATGGAAAGGGGG - Intronic
919080311 1:192857925-192857947 GGTTTTGTGGAATGGAAAGGGGG + Intergenic
919105797 1:193148893-193148915 GGTTTTCTGGAAGGCCGAGGTGG - Intronic
920784446 1:209027425-209027447 TGCTTTTTTGAAGGGGAAGGTGG + Intergenic
921340572 1:214129783-214129805 GGATTTATTGATGGCCAAGTTGG - Intergenic
921887748 1:220323453-220323475 GGTTTTAAGGCAGGGCACGGTGG - Intergenic
1066241420 10:33539438-33539460 GGATACATTGAAGGGAAAGGAGG - Intergenic
1067428178 10:46224846-46224868 AACTGTATTGAAGGGCAAGGAGG + Intergenic
1069431237 10:68336367-68336389 GGTTATTTTGGAGGGGAAGGGGG + Intronic
1071225192 10:83520728-83520750 GGTTTTGTTGAAAGGAAAAGGGG + Intergenic
1071335018 10:84593576-84593598 GGCTTTATAAAAGGGCAGGGAGG - Intergenic
1071927601 10:90428570-90428592 GGTTTTAAAGATGGGCAAAGGGG - Intergenic
1073488313 10:103835832-103835854 GGCTTCAGTGAAGGCCAAGGAGG - Intronic
1074218320 10:111409869-111409891 GGATTGATTGGAGGGCAAGGAGG - Intergenic
1074595789 10:114865590-114865612 GCTTCTTTTGAAGGGCAAGGAGG - Intronic
1078667706 11:13340187-13340209 GGTTTGGTTGACTGGCAAGGAGG - Intronic
1081976670 11:47239761-47239783 GGCTTGATAGAAGTGCAAGGTGG + Exonic
1083325197 11:61869545-61869567 GGAAGTATTCAAGGGCAAGGCGG - Intergenic
1083593810 11:63909759-63909781 GGTTTGCTTGGAGGGGAAGGAGG - Exonic
1083962957 11:66024645-66024667 GGCCTTATTGGAGGGCAAGGAGG - Intronic
1084256018 11:67943340-67943362 GGTTTTCTGGAAGGGGGAGGCGG + Intergenic
1084816741 11:71651970-71651992 GGTTTTCTGGAAGGGGGAGGTGG - Intergenic
1085221024 11:74873830-74873852 GGTTTTAGGGAGGGGGAAGGAGG - Intronic
1086104592 11:83133721-83133743 GGTTTTGTGGAATGGAAAGGGGG + Intergenic
1086342344 11:85858810-85858832 AGCTATATTGAAGGGCAAAGAGG + Intronic
1087377004 11:97355876-97355898 GGATTTATCGAAGGGCTAGGAGG + Intergenic
1089300646 11:117496803-117496825 GGTTTTATTAAAGGGATAGGAGG - Intronic
1090492255 11:127175177-127175199 GCTTTTAATGAAGGACAAGCAGG + Intergenic
1091778891 12:3201526-3201548 GGTTTTCTTATAGGGGAAGGAGG - Intronic
1092426248 12:8378083-8378105 GGTTTTCTGGAAGGGGGAGGCGG + Intergenic
1092843924 12:12566448-12566470 GGTTTTGTGGAATGGAAAGGGGG + Intergenic
1093040680 12:14376238-14376260 GTTTTTAAAGGAGGGCAAGGAGG - Intronic
1093349083 12:18074025-18074047 TGTTTTATTGAGGTGGAAGGTGG + Intergenic
1097626948 12:62011290-62011312 GGTTTTGTTGAAAGGAAAAGGGG + Intronic
1098584840 12:72142906-72142928 GGTTTTATTGAGTGGTGAGGTGG - Intronic
1100143838 12:91653089-91653111 GGTTTTTTGTAAGAGCAAGGTGG - Intergenic
1100736797 12:97544057-97544079 TTTTTGATAGAAGGGCAAGGAGG - Intergenic
1101507178 12:105358226-105358248 GGTTTTATAGCTGGGCATGGTGG + Intronic
1101670855 12:106871531-106871553 GTTATTTTTGAAGGGGAAGGAGG - Intronic
1105692741 13:22858861-22858883 GGTTTTGTGGAATGGAAAGGGGG - Intergenic
1107104956 13:36633211-36633233 GCAGTTATTGAAGGACAAGGTGG + Intergenic
1108191451 13:47944602-47944624 GGATATATTGAAGGGAAAAGGGG - Intronic
1109404227 13:61876714-61876736 GATTTTATTCAAAGGCAAAGAGG - Intergenic
1109980499 13:69900148-69900170 GATGTTATTGAAGGGCATAGAGG - Intronic
1110816789 13:79870034-79870056 TGTTTTTGTGGAGGGCAAGGCGG - Intergenic
1111113889 13:83750446-83750468 GGTTTTATTGTATGGTAAGGAGG - Intergenic
1113659254 13:112093888-112093910 GGTTTGATTCAAGGGCAAAAGGG + Intergenic
1114247101 14:20924471-20924493 GGTTAAATGGAAGGTCAAGGAGG + Intergenic
1115852169 14:37597340-37597362 GGTGTTATTGAAGAGCCAAGAGG - Intronic
1117861270 14:60094792-60094814 GGTTTTTTTTAAAGGGAAGGTGG - Intronic
1118999911 14:70872464-70872486 GGTCATATTGAAGGGTGAGGAGG + Intergenic
1119666239 14:76486916-76486938 CGCTTTACTGAAGGGCAGGGAGG + Intronic
1119999850 14:79290401-79290423 GGTGTCATAGAAGGGAAAGGAGG + Intronic
1121402406 14:93691466-93691488 AGTTTCATTAAAGGGCAAGGGGG + Intronic
1121771061 14:96540201-96540223 GGTTTTGTTGAAGACTAAGGTGG + Intronic
1126132869 15:45360023-45360045 GGCTTTCTTTAAGGGAAAGGTGG + Intergenic
1126600071 15:50419110-50419132 AGCTATATTGAAGGGCAAGGAGG + Intergenic
1127353276 15:58173638-58173660 TGTTTGATAGAAGGGCAATGAGG - Intronic
1132573435 16:653963-653985 GGTTTTTGTGCAGGGCACGGGGG - Intronic
1133372085 16:5252833-5252855 GGTTTTCTGGAAGGGGGAGGTGG - Intergenic
1133519721 16:6545294-6545316 GTTTTTATTGAAGGCCAGGAGGG - Intronic
1135231079 16:20708011-20708033 GTTTTTCTTGCAGGGCATGGTGG + Intronic
1135385832 16:22038748-22038770 GGTTGTATTGAGGGGCTAGTTGG + Intronic
1136485998 16:30571998-30572020 GGCTTTATTTAAGGGCAAGTGGG - Exonic
1138238463 16:55406359-55406381 GGCTTTCTGGAAGGGCAAGTTGG - Intronic
1140746324 16:77983433-77983455 GGTCCCATTGAAGGGTAAGGAGG + Intergenic
1145771864 17:27499041-27499063 GGTTTTAGAGCAGGGCCAGGAGG + Intronic
1146187692 17:30736181-30736203 GGTTTTGTGGAATGGAAAGGGGG - Intergenic
1146497737 17:33337943-33337965 GGTGTTCTGGAAGGGCAAAGAGG + Intronic
1146497749 17:33338026-33338048 GGTGTTCTGGAAGGGCAAAGAGG + Intronic
1146497776 17:33338192-33338214 GGTGTTCTGGAAGGGAAAGGAGG + Intronic
1146497784 17:33338233-33338255 GGTGTTCTGGAAGGGCAAGGAGG + Intronic
1146817946 17:35959152-35959174 GATTTCATTCAAGGGCAAGGAGG + Intergenic
1147738963 17:42659632-42659654 GGGTTCATGGAAGGGAAAGGGGG - Intronic
1147867593 17:43563448-43563470 GGTTTTCCTGGAGGGCAAGGGGG + Intronic
1150198273 17:63324945-63324967 GATTTCATTCAAGGGCAAGGAGG - Intronic
1152648167 17:81479848-81479870 GGTGGCTTTGAAGGGCAAGGAGG - Intergenic
1154365915 18:13708914-13708936 GGATTTGCTGAAGGGCAAGGTGG - Intronic
1156179710 18:34588478-34588500 GGTTTTAAGAAAGGGCAAGGAGG - Intronic
1156305596 18:35875554-35875576 GGTTTTAGGGAGGGGGAAGGAGG - Intergenic
1162393787 19:10404774-10404796 GGTTTGAATGAAGCGCGAGGGGG - Intronic
1164362651 19:27532857-27532879 GGATATATTGAAGAGCATGGAGG + Intergenic
1166250048 19:41563737-41563759 GCCTTGAGTGAAGGGCAAGGGGG + Intronic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
1166611789 19:44204357-44204379 GGTTTTGTTGAATAGAAAGGGGG + Intergenic
925674008 2:6340897-6340919 GGTTTTCGTGAAGGGGATGGAGG - Intergenic
925980982 2:9177253-9177275 AGTTCTATGGAAGGCCAAGGAGG + Intergenic
926965581 2:18406314-18406336 GGCTTTTTTAAAGGGCCAGGTGG + Intergenic
929473009 2:42215338-42215360 GGTTTTATGGCTGGGCATGGTGG - Intronic
929871359 2:45761919-45761941 GGTGGTCCTGAAGGGCAAGGAGG - Intronic
930198729 2:48532722-48532744 GGTTGTAATGAAGGCCACGGGGG + Intronic
932903478 2:75725329-75725351 GGTTTTGTGGAATGGAAAGGGGG + Intergenic
933246751 2:79984769-79984791 GGATATAGTGAAGGGAAAGGAGG - Intronic
934733311 2:96673006-96673028 GGTTATATTGACAGGCAGGGAGG - Intergenic
935546538 2:104405772-104405794 GGATTTGTTGATTGGCAAGGTGG - Intergenic
935653609 2:105403169-105403191 TGTTTTATTCAATGGCAAAGGGG + Intronic
936307250 2:111353966-111353988 GGTGTCATGGAATGGCAAGGTGG - Intergenic
938451057 2:131420817-131420839 GGTTTTATTGAAGGGGCTAGGGG - Intergenic
939362246 2:141187625-141187647 GGTATTATTAGAGGGCCAGGAGG - Intronic
940989697 2:160085062-160085084 GGTTTTAGGGAGGGGAAAGGAGG + Intergenic
942363605 2:175198371-175198393 GGTTTCAATAATGGGCAAGGTGG - Intergenic
942754018 2:179319408-179319430 GGTTTTGTGGAATAGCAAGGCGG - Intergenic
942967517 2:181914954-181914976 TGTTGTATTGAAAGGAAAGGGGG + Intronic
943125598 2:183791674-183791696 GGTTTTATTGAAAAGAAAAGGGG - Intergenic
943292764 2:186095987-186096009 TTTTTTATTGAAGGTAAAGGAGG + Intergenic
944254735 2:197614408-197614430 GGTTTTATTGAGGGTAGAGGTGG - Intronic
944544039 2:200781463-200781485 GTTTTTGTTGAAGGGCAGGATGG - Intergenic
946437178 2:219664975-219664997 TGGTTTACTAAAGGGCAAGGTGG + Intergenic
948050961 2:234978989-234979011 CGTTTCTTTGCAGGGCAAGGTGG + Intronic
948214557 2:236219161-236219183 GGTTTTTTGGCAGGGCACGGTGG - Intronic
1169564216 20:6835783-6835805 AGTTTTTTTGAAGGGGACGGAGG + Intergenic
1169670734 20:8098472-8098494 TGTTTTAATGTAGGGCAAGCAGG - Intergenic
1170310468 20:14985924-14985946 GGTATTTCTGCAGGGCAAGGTGG - Intronic
1170673513 20:18457185-18457207 GGCTTTATGGCAGGGCACGGTGG + Intronic
1172356014 20:34280592-34280614 GGCTATATTGAAGGGCAAAGAGG - Exonic
1172906109 20:38370754-38370776 GCTGGTATTGAAGGTCAAGGTGG - Exonic
1172998908 20:39091610-39091632 GGTTTGATATGAGGGCAAGGGGG + Intergenic
1178318143 21:31584359-31584381 GGTTTTGTGGAATGGAAAGGGGG - Intergenic
1180030035 21:45200575-45200597 GGCTTTATTGTAGGGAAAGGGGG + Intronic
1181046090 22:20215006-20215028 GGTGGGATTCAAGGGCAAGGCGG + Intergenic
949662556 3:6296017-6296039 GGTTTTTTTGAAAGGTAGGGTGG - Intergenic
951482869 3:23180127-23180149 AGTATTATTGAGGGGTAAGGGGG - Intergenic
952346275 3:32489361-32489383 GGTTTTCTTGCCGGGCACGGTGG + Intronic
952892700 3:38053736-38053758 GGTTTTGTTGAATGGAAAAGGGG + Intronic
954483436 3:50823619-50823641 GGTTTTGTGGAATAGCAAGGGGG - Intronic
955299501 3:57763611-57763633 TGTTTTAGTGAAGGGCATAGTGG + Intronic
956840670 3:73137106-73137128 GGTCTGATTGAAGGGACAGGTGG - Intergenic
957070928 3:75567373-75567395 GGTTTTCTGGAAGGGGGAGGTGG + Intergenic
957203471 3:77165102-77165124 GGTTTTGTGGAATGGAAAGGGGG + Intronic
958621100 3:96562068-96562090 GGTTTTATTGATGGGTAGGTGGG + Intergenic
958999206 3:100941927-100941949 GTTTTTTTGGAAGGGGAAGGTGG + Intronic
959406165 3:105963830-105963852 GGTTTTATTGAACGTCTTGGGGG + Intergenic
959934405 3:112014279-112014301 GGTTTTATTGAATGGATGGGTGG + Intergenic
960059869 3:113310100-113310122 GGTGTTAGAGAAGGGCAAGCAGG + Intronic
960431998 3:117580731-117580753 GGTTTTTATGAGGGACAAGGAGG - Intergenic
960924082 3:122779961-122779983 GGTTTTGTGGAATGGAAAGGGGG - Intronic
961076506 3:123987474-123987496 AATTTTATTGGAGGGCAAGATGG - Intronic
961099675 3:124187842-124187864 GGCTTTGTTGAAGGGCAATTAGG + Intronic
961283191 3:125779350-125779372 GGTTTTCTGGAAGGGGGAGGTGG - Intergenic
962166168 3:133050672-133050694 GGGTTTAGTGAAGGGCAAAGGGG - Intronic
963178655 3:142329685-142329707 GGTTTTATAGAAGAGCAAGCAGG + Intronic
963761765 3:149292148-149292170 GGTTTTAGGGAAGGGAAAGGAGG - Intergenic
963785789 3:149533134-149533156 GGTTTGTTTGGAGGGCAGGGTGG - Intronic
964435620 3:156649409-156649431 GGTTTTACTGCAGGCCCAGGTGG + Intergenic
965817784 3:172654605-172654627 GGTCATATTGAAGGGGAAGGAGG + Intronic
966973872 3:185068814-185068836 GGGTTTATTGAAGGGCCTGATGG + Intergenic
967067625 3:185934317-185934339 GATTTTATTGTAGAGAAAGGAGG + Intronic
967177724 3:186874603-186874625 GGTTTTGTGGAATGGAAAGGGGG + Intergenic
967757589 3:193187625-193187647 GGCTTCATGGAAGGGAAAGGTGG - Intergenic
967869251 3:194216352-194216374 GGTTTTATTGAAGAGGAGCGGGG - Intergenic
969014533 4:4095064-4095086 GGTTTTCTGGAAGGGGGAGGTGG + Intergenic
969739419 4:9013375-9013397 GGTTTTCTGGAAGGGGGAGGCGG - Intergenic
969798600 4:9544890-9544912 GGTTTTCTGGAAGGGGGAGGCGG - Intergenic
973109360 4:46378199-46378221 GGTTTTGTGGAATGGAAAGGGGG + Intronic
974073562 4:57147895-57147917 GGTTTTACTGAAGTTCCAGGAGG + Intergenic
974121126 4:57640354-57640376 GGTTTTATTGATGGTGGAGGTGG - Intergenic
974280975 4:59792596-59792618 GCTTTTATAGAATGTCAAGGAGG - Intergenic
974443928 4:61954650-61954672 GTTTTTGTGGAAAGGCAAGGAGG - Intronic
975486850 4:74943232-74943254 TGTTTTAGTGAGGGGTAAGGAGG - Intronic
976234770 4:82884711-82884733 GGCTCTATTGAAAGGAAAGGAGG - Intronic
977345531 4:95811896-95811918 GGCCTCATGGAAGGGCAAGGAGG + Intergenic
978123761 4:105110781-105110803 GGTTTTGTGGAATGGAAAGGCGG + Intergenic
980704441 4:136474739-136474761 GCTTTTATTTAAGGGCAAAAAGG - Intergenic
982509111 4:156258417-156258439 GGCTTTATTGAAGGGTTTGGAGG + Intergenic
986353257 5:6900233-6900255 TGTCTTTTTGATGGGCAAGGAGG + Intergenic
988604054 5:32665268-32665290 GGTTTTGGGGAAGGGAAAGGAGG + Intergenic
992372324 5:76155975-76155997 GGTTGTAGTGAAAGGCAATGGGG + Intronic
995995310 5:118291484-118291506 GGTTTTATTGTGGTACAAGGTGG + Intergenic
996742117 5:126809397-126809419 GGTTTTATGGCTGGGCAAGGTGG + Intronic
997206058 5:132050853-132050875 GCTTTGAGTGAAGGGCATGGGGG + Intergenic
997472496 5:134124670-134124692 GGTTTTAATGGGGGGCAGGGCGG - Intronic
999001806 5:147931870-147931892 GGGTTAATTGAAGGGCAAGAAGG + Intergenic
999043568 5:148443620-148443642 GGCTTAATTGAAGCCCAAGGGGG + Intergenic
999585587 5:153086509-153086531 TGTTTTTCTGAAGGGCAAGGTGG - Intergenic
1001430367 5:171656688-171656710 GGGATTATTGAAGGGAAAGCAGG + Intergenic
1003552432 6:7110167-7110189 AGTTTAATTGAAGTGGAAGGTGG + Intronic
1004850187 6:19691278-19691300 GGTGTTAGTGATAGGCAAGGAGG - Intergenic
1007060878 6:38939952-38939974 GGTTTTGTTGAAATGAAAGGTGG + Intronic
1008719800 6:54335060-54335082 GCTTTTATTGAGGGCCACGGTGG + Intronic
1008776728 6:55048760-55048782 GGATTTAGTGGAGGGCATGGAGG - Intergenic
1013657182 6:112258182-112258204 GGTTTTTTTGAATTGCATGGTGG - Intergenic
1014463595 6:121729528-121729550 GGTTTTGTTGAGTGGAAAGGGGG - Intergenic
1014905253 6:127018866-127018888 GATATTATTGAAGGGGATGGTGG - Intergenic
1015034563 6:128637944-128637966 TTTTTTATTAAAGGGCAAGGTGG + Intergenic
1015843492 6:137495981-137496003 GGTTTGAGTCAAGGGAAAGGGGG - Intergenic
1018082862 6:160273659-160273681 GGTTTTATGGAAGTCCAGGGGGG + Intronic
1019065376 6:169291844-169291866 GGTTTTATGAAAATGCAAGGTGG - Intergenic
1020112987 7:5458224-5458246 GGTTTTATTGACGGACAGTGTGG - Intronic
1022876629 7:34539843-34539865 GGGCTTATTGGAGGGCAGGGTGG - Intergenic
1023389155 7:39691206-39691228 GGTTTTGGTGAAGGGGAAAGAGG + Intronic
1023696238 7:42850415-42850437 GCTTTTATTGAAGGCCTAGGTGG - Intergenic
1024124962 7:46284270-46284292 GGTTTTCTTCAAGGCCCAGGAGG + Intergenic
1025871265 7:65436551-65436573 TGTTGTTTTGAAGGGCAAGTGGG - Intergenic
1027290961 7:76710256-76710278 GATTTTTTTGAAGGGGAAGAAGG - Intergenic
1029073210 7:97916695-97916717 GGTTTTCTGGAAGGGGGAGGCGG + Intergenic
1033795806 7:144843286-144843308 GGTTTTTCTGAGGGGCGAGGGGG + Intergenic
1034034052 7:147801777-147801799 GGTTTTGTGGAATGGAAAGGGGG - Intronic
1036244482 8:7104601-7104623 GGTTTTCTGGAAGGGGGAGGCGG - Intergenic
1036256256 8:7209141-7209163 GGTTTTCTGGAAGGGGGAGGCGG + Intergenic
1036308306 8:7667725-7667747 GGTTTTCTGGAAGGGGGAGGCGG + Intergenic
1036889747 8:12588650-12588672 GGTTTTCTGGAAGGGGGAGGTGG + Intergenic
1036897350 8:12646802-12646824 GGTTTTCTGGAAGGGGGAGGCGG + Intergenic
1037743175 8:21623260-21623282 GGCTTTATTTATGGGCAAGAGGG + Intergenic
1038475540 8:27864018-27864040 GGTCTTAATGAAGAGGAAGGAGG + Intergenic
1041086971 8:54265728-54265750 GGTTATTTTGGAGGGCAAGGAGG + Intergenic
1041269473 8:56097462-56097484 GGTTCTATTTAAGAGTAAGGCGG + Intergenic
1043541789 8:81271652-81271674 GGTTTTCTTGAGGAACAAGGGGG + Intergenic
1044084817 8:87931376-87931398 GGTTTTATTAAAGTGGAAGGAGG + Intergenic
1052109279 9:24560688-24560710 AGTTTAATTGAAGGGAGAGGAGG + Intergenic
1055582212 9:77718325-77718347 GGTTTTATTGAAGGGGCTAGGGG - Exonic
1056444440 9:86652215-86652237 GGTTTTAATGCAGGACAAGTGGG + Intergenic
1056876563 9:90338951-90338973 GGTGTGATTGAAGGGGTAGGGGG - Intergenic
1058328443 9:103727591-103727613 GGTTTTATTGATGAGCAGAGTGG + Intergenic
1058375539 9:104316959-104316981 GGTTTCATTGAAAAGAAAGGGGG + Intergenic
1060493647 9:124102459-124102481 GGTCTTATTGAAGGGAAGGGTGG - Intergenic
1061421236 9:130473767-130473789 GGGCTGATTGAAGGGCAATGAGG + Intronic
1061504884 9:131026240-131026262 CATTTTATGGAAGGGGAAGGAGG - Intronic
1061916617 9:133758817-133758839 GGTTTTTTGGGAGGCCAAGGTGG + Intergenic
1062150352 9:135015116-135015138 GGTTTTATTGAAGTCCACTGGGG + Intergenic
1062508278 9:136889570-136889592 GGTTTTAAGGCCGGGCAAGGTGG - Intronic
1189506146 X:41613172-41613194 GGTTTTGTGGAATGGAAAGGGGG + Intronic
1189800406 X:44686760-44686782 GGTTTTGTGGAAGAGAAAGGTGG + Intergenic
1189968147 X:46395111-46395133 GGTTTTGTGGAATGGAAAGGGGG - Intergenic
1194974700 X:100382236-100382258 GGTTTTAAGGAAGTGCTAGGTGG - Intronic
1194992145 X:100556201-100556223 GGTTTTGTGGAATGGAAAGGCGG + Intergenic
1195454103 X:105049051-105049073 GGTTTTATTGAGGGGATAGGTGG - Intronic
1196698071 X:118635176-118635198 GGCTTTATGGAGGGGCAAGGAGG - Intronic
1197194176 X:123681351-123681373 TTTGTTATTGAAGGGAAAGGTGG + Intronic
1198125754 X:133642040-133642062 GGTTTGATTGTGGGGCAGGGTGG - Intronic
1201476275 Y:14385300-14385322 AGTTTTCCTGAAGTGCAAGGTGG + Intergenic
1201613723 Y:15872019-15872041 GGTATTTTAGAAGGCCAAGGTGG - Intergenic
1201625574 Y:16011465-16011487 GGTTTTTGTGAAGGGCCAGAGGG - Intergenic