ID: 906984204

View in Genome Browser
Species Human (GRCh38)
Location 1:50665797-50665819
Sequence ATGCATATTATTTTGTAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 301}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906984204_906984205 9 Left 906984204 1:50665797-50665819 CCAGGTTACAAAATAATATGCAT 0: 1
1: 0
2: 2
3: 35
4: 301
Right 906984205 1:50665829-50665851 AGTTATGTCTGTATAAGTATAGG 0: 1
1: 0
2: 1
3: 11
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906984204 Original CRISPR ATGCATATTATTTTGTAACC TGG (reversed) Intronic
902085161 1:13854509-13854531 ATACATATTATTTCATTACCCGG + Intergenic
903202010 1:21748968-21748990 ATGTATATAATTTTGTATTCTGG - Intronic
905330503 1:37192131-37192153 AAGCATATTATTTGGAAACATGG - Intergenic
906984204 1:50665797-50665819 ATGCATATTATTTTGTAACCTGG - Intronic
908469218 1:64425896-64425918 ATGCATTTTATTTTGTGTCCTGG - Intergenic
908686726 1:66729019-66729041 GTACAGATTATTTTGTCACCTGG - Intronic
909071848 1:71004182-71004204 ATCCATAGTCTTTTGTAACTTGG + Intronic
909251167 1:73358474-73358496 ATGCATAATAGTTTGTAAAGGGG + Intergenic
912119390 1:106451881-106451903 ATTCATATTATTTCAGAACCAGG + Intergenic
913573737 1:120147991-120148013 GTACAGATTATTTTGTTACCTGG + Intergenic
914294999 1:146312793-146312815 GTACAGATTATTTTGTTACCTGG + Intergenic
914556040 1:148763576-148763598 GTACAGATTATTTTGTTACCTGG + Intergenic
914880755 1:151544818-151544840 AAGCATATTATTTAGAAACATGG - Intronic
916604626 1:166328496-166328518 CAGCTTATTATTTTGTTACCTGG + Intergenic
917270182 1:173264042-173264064 ATACAGATTATTTTGTCACCAGG - Intergenic
918581983 1:186142083-186142105 GTACAGATTATTTTGTCACCTGG + Intronic
918758088 1:188362757-188362779 ATGCATATTATATTTGAACACGG + Intergenic
918771468 1:188566278-188566300 ATGCATATCATTGTACAACCAGG + Intergenic
920358053 1:205390592-205390614 CTGCAGATTATTTTGTAGCCTGG - Intronic
920528213 1:206684354-206684376 AGACGTATTATTGTGTAACCAGG - Intronic
921348778 1:214214225-214214247 ATGCATTTTGTTTTGCAAGCAGG - Intergenic
923930339 1:238687301-238687323 GTACACATTATTTTGTCACCGGG - Intergenic
924686718 1:246299924-246299946 GTACAGATTATTTTGTCACCAGG - Intronic
924824840 1:247528533-247528555 ATGCAGATTCATTTGTAAACTGG - Intronic
924865027 1:247969661-247969683 ATGCAGATTATTTTCAAATCTGG - Intronic
1064168988 10:13012818-13012840 GTACAAATTATTTTGTCACCAGG - Intronic
1067983839 10:51118904-51118926 CTTCAAATTATTTTGGAACCTGG + Intronic
1068368597 10:56084669-56084691 ATGCTTGGTATTTTGTAACTTGG + Intergenic
1068878203 10:62020172-62020194 ATGCATAGTATTTGGAACCCAGG - Intronic
1069322757 10:67193427-67193449 TTACAGATTATTTTGTCACCAGG + Intronic
1069329266 10:67271708-67271730 ATGCCTATTATTTTTTTCCCTGG - Intronic
1070379507 10:75867971-75867993 AGGAATAATATTTTGTGACCTGG - Intronic
1071003545 10:80857445-80857467 ATGCACAGTATTGTTTAACCGGG - Intergenic
1072396032 10:95042255-95042277 ATGTATATTATTTTGCTATCTGG - Intronic
1072844041 10:98808625-98808647 AAGCATGTTATTTTATAACTAGG + Intronic
1073416258 10:103385448-103385470 ATGGATATTATTTTGTGTCAGGG + Exonic
1073522862 10:104150815-104150837 GTACAGATTATTTTGTCACCAGG + Intronic
1074238792 10:111614727-111614749 ATTAAAATTATTTTGTACCCAGG - Intergenic
1076030646 10:127154994-127155016 CTGGATATTATTTTGTGTCCAGG + Intronic
1076294127 10:129371318-129371340 AGGGATATTATTTTCTAACTAGG + Intergenic
1076455792 10:130593894-130593916 GTACAGATTATTTTGTCACCCGG - Intergenic
1078876381 11:15403062-15403084 ATGCATAATCTTTGTTAACCAGG + Intergenic
1078979099 11:16511773-16511795 CTGCATGTTATTTTGCAACTTGG - Intronic
1079561616 11:21828460-21828482 ATGCACATGATATTATAACCTGG + Intergenic
1079688713 11:23396285-23396307 ATGCATATTATTTAGAAATATGG + Intergenic
1080527530 11:33141320-33141342 ATTCATATTAGTTTGTAAGTAGG + Intronic
1083053687 11:59799368-59799390 ATGCTTATAATTTTCTAACTGGG - Intronic
1085619736 11:78028886-78028908 ATGCATGTCATTTAATAACCTGG - Intronic
1085708469 11:78808089-78808111 ATTAATTATATTTTGTAACCTGG + Intronic
1086024738 11:82277201-82277223 ATGCATATTTTTTAGTTATCAGG - Intergenic
1086665380 11:89474614-89474636 GTGCATATTATTCAGTAATCTGG - Intronic
1086773752 11:90802527-90802549 ATGAACATTATTTTTTAATCCGG + Intergenic
1087466677 11:98516759-98516781 TTACAAATTATTTTGTCACCCGG + Intergenic
1088977767 11:114831019-114831041 AGACATATTAGTTTGAAACCGGG + Intergenic
1089884889 11:121810709-121810731 GTACACATTATTTTGTCACCCGG + Intergenic
1092393624 12:8104657-8104679 ATACAGATTATTTTGTCGCCTGG + Intergenic
1093223923 12:16458214-16458236 ATTCATATTATTTTGGAGGCAGG - Intronic
1093862151 12:24179353-24179375 ATGCATATCATTTTGTACTGTGG - Intergenic
1093865971 12:24227931-24227953 ATGCATATTATTATGTGACAGGG - Intergenic
1095586070 12:43850775-43850797 ATGCTAATTATTTGGGAACCAGG - Intronic
1096904424 12:54921179-54921201 ATGCATTTTATTTAGAAATCTGG - Intergenic
1097864879 12:64551568-64551590 ATGCATATTATTTTTGAGACAGG - Intergenic
1098317136 12:69204659-69204681 ATGCATTTTATTTGGTTAGCAGG + Intergenic
1100182528 12:92100717-92100739 ATGCATGTTATTTTCCAGCCAGG - Intronic
1100238664 12:92686979-92687001 ATGCATAAAATTATGTAACGAGG + Intergenic
1100321970 12:93503843-93503865 GTGCATATTATTCTATAATCTGG + Exonic
1100582648 12:95949697-95949719 ATGCATATTGTTTTGTATTCGGG + Intronic
1101183863 12:102251826-102251848 ATGCATTTTATTTTCTAGCAGGG + Intergenic
1101306424 12:103532274-103532296 ATACATATTATTTTCTCACCTGG - Intergenic
1101745956 12:107541823-107541845 GTACAGATTATTTTGTCACCAGG - Intronic
1103837280 12:123832681-123832703 AGGCATATCATTTTGTAATTTGG + Intronic
1105934548 13:25087077-25087099 GTACAGATTATTTTGTCACCAGG + Intergenic
1108314630 13:49225169-49225191 ATGTATTTTATTTTGTGAACCGG - Intergenic
1109114203 13:58360534-58360556 GTACAGATTATTTTGTAACCAGG - Intergenic
1109259645 13:60128931-60128953 ATATATTTTATTTTGTAGCCTGG - Intronic
1109766743 13:66910166-66910188 AGCCATTTTATTTTTTAACCAGG + Intronic
1110085782 13:71377567-71377589 ATGCATATTATTTTTTTTCAGGG - Intergenic
1111874303 13:93874133-93874155 ATACAGATTATTTTATCACCAGG + Intronic
1111965787 13:94860044-94860066 ATGTATCTTCTTTAGTAACCAGG - Intergenic
1112370062 13:98786161-98786183 ATTGTTATTATTTTTTAACCAGG - Intergenic
1113563958 13:111306715-111306737 ATGCTTTTTACTTTGTATCCTGG - Intergenic
1114381468 14:22209385-22209407 ATGCAATTTCTTTTGAAACCAGG - Intergenic
1114891542 14:26930324-26930346 ATGCATATTATTTTGTACAATGG - Intergenic
1115146161 14:30228534-30228556 ATGCATATTATTATGTGCCAAGG + Intergenic
1116319723 14:43446293-43446315 GTACATATTATGTTGTCACCAGG + Intergenic
1116782984 14:49256961-49256983 ATACAGATTATTTTATCACCAGG - Intergenic
1116805223 14:49488008-49488030 ATACAGATTATTTTGTCACCAGG + Intergenic
1117796538 14:59400182-59400204 ATACTTATTATTTTATAAACCGG - Intergenic
1117927777 14:60802337-60802359 ATGCTTATTTTTTTGTAGCAAGG - Intronic
1118638573 14:67771051-67771073 GTACAGATTATTTTGTCACCTGG + Intronic
1121945042 14:98111961-98111983 AGGCAAATTATTTATTAACCAGG - Intergenic
1123913078 15:24989491-24989513 ATGCTTTTTTTTTTTTAACCTGG - Intergenic
1124786802 15:32689255-32689277 ATGCATATTATTATGTATTCTGG + Intronic
1126221328 15:46217208-46217230 GTGCATATTATTTTGTTCACAGG + Intergenic
1128154337 15:65383414-65383436 CTGCATTTAATTTTGTAATCTGG - Exonic
1132328022 15:100988225-100988247 ATGCAGATTATTTCGTCACCTGG + Intronic
1133456455 16:5946547-5946569 ATGCATATTTTTTTCCAACTGGG + Intergenic
1134382853 16:13744512-13744534 GTGCAGATAATTTTGTCACCTGG + Intergenic
1136695787 16:32080240-32080262 ATACATTTTATTTTATAACTTGG - Intergenic
1136796283 16:33023493-33023515 ATACATTTTATTTTATAACTTGG - Intergenic
1136873634 16:33830904-33830926 ATACATTTTATTTTATAACTTGG + Intergenic
1137496137 16:48970762-48970784 CTGCATATTATTTTACAAGCTGG - Intergenic
1138996340 16:62457915-62457937 ATACATATTATTTTATCACCCGG + Intergenic
1140153166 16:72393170-72393192 ATGCATATAATTGTGTAAAGGGG + Intergenic
1141244856 16:82296303-82296325 ATGCATATCCTTATATAACCAGG - Intergenic
1141377724 16:83547386-83547408 GTACAGATTATTTTGTCACCTGG + Intronic
1203098540 16_KI270728v1_random:1285152-1285174 ATACATTTTATTTTATAACTTGG - Intergenic
1143124680 17:4634093-4634115 GTACAGATTATTTTGTCACCAGG - Intronic
1143760423 17:9099023-9099045 TTGCATATTGTTTTGTAACCTGG + Intronic
1146978794 17:37140455-37140477 ATGCATATTGATCTGTAGCCAGG - Intronic
1149101570 17:52912541-52912563 GTGCATATTATTTCATCACCCGG - Intergenic
1149171547 17:53817884-53817906 AAGCTTATTTTTTTTTAACCTGG + Intergenic
1149217922 17:54380017-54380039 ATGCATGATATTCTGTAAGCAGG + Intergenic
1153717215 18:7862099-7862121 ATGCATATCATTTTGAAAAGAGG - Intronic
1153861362 18:9211837-9211859 ATGTAGATTAAATTGTAACCAGG - Intronic
1154098341 18:11442114-11442136 ACACAAATTATTTTGAAACCTGG - Intergenic
1155982789 18:32198137-32198159 ATGCATATGCTTTTCTATCCAGG - Intronic
1156098339 18:33563092-33563114 ATGCATTCTCTTTTGTAACAGGG - Intergenic
1156723441 18:40098628-40098650 ATGCATATTATTTTCCCTCCAGG - Intergenic
1158187037 18:54782267-54782289 ATACATTTTGTTTTGTAAACAGG - Intronic
1159125846 18:64223573-64223595 ATGCATATTATTTTATAATATGG - Intergenic
1159171044 18:64767337-64767359 ATACAGATTATTTTGTCACTTGG + Intergenic
1159484043 18:69030415-69030437 ATTTTCATTATTTTGTAACCAGG - Intronic
1160086716 18:75783346-75783368 CTGCATATTTTTTGGCAACCTGG - Intergenic
1160366553 18:78331253-78331275 ATGCATATTTCTGTGTAACATGG + Intergenic
1162433630 19:10643862-10643884 ATTATTATTATTTTTTAACCTGG + Exonic
1162850857 19:13430110-13430132 ATTCATATTGTTGTGCAACCAGG - Intronic
1162894388 19:13756420-13756442 ATGCTTATTGTTTTGTCACACGG - Intronic
1165089833 19:33379122-33379144 ATGCAATTTATTTTTTAACTAGG + Exonic
926618511 2:15024049-15024071 ATACAGATTATTTTGTCACTCGG + Intergenic
928433236 2:31237375-31237397 ATACATATAATTTTGTATGCTGG + Intronic
928552722 2:32389393-32389415 ATTCCTATTATTTTTTAAACTGG - Intronic
932920867 2:75914149-75914171 GTGCAGATTATTTTGCCACCAGG + Intergenic
933400758 2:81794010-81794032 AGGCATATTATATTGTATACTGG - Intergenic
935602594 2:104938382-104938404 ATGCATATAAATTTGGAACAGGG - Intergenic
936101170 2:109581011-109581033 ATGCATATTATTCTTTAGCCAGG - Intronic
937413928 2:121699422-121699444 ATGCATATTTTTTTGAGACAGGG - Intergenic
939249740 2:139668458-139668480 ATATATATTATTTTGTAATTTGG - Intergenic
939250751 2:139679187-139679209 ATGAAGATTATTTGGTAACCAGG + Intergenic
939784353 2:146491426-146491448 AGTCACATTATTTTATAACCAGG + Intergenic
940127920 2:150347746-150347768 ATACATATTATTTTGCACACTGG + Intergenic
940428655 2:153560413-153560435 ATGAATGTTTTTTTTTAACCTGG - Intergenic
942725907 2:179007470-179007492 ATGCATGTTACTTTGGAACATGG + Intronic
943169868 2:184385083-184385105 ATGACTATTATTTTTTAAACTGG - Intergenic
943861302 2:192866688-192866710 ATACAGAATATTCTGTAACCTGG - Intergenic
944740582 2:202608250-202608272 ATGCATAGTTATTTGTTACCTGG + Intergenic
945077355 2:206053362-206053384 ATACATGCTGTTTTGTAACCTGG - Intronic
945541889 2:211098201-211098223 GTACATATTATTTCGTCACCTGG + Intergenic
946811978 2:223535570-223535592 AAGCATTTTGTTTTATAACCAGG - Intergenic
946931013 2:224671270-224671292 CTGCATATTATCTTTTAACAAGG + Intergenic
947185578 2:227452447-227452469 ATGAAGTTTATTTTGTCACCAGG + Intergenic
947329662 2:229015362-229015384 ATGCATATTTTTTTATAAGCAGG + Intronic
948584449 2:239010493-239010515 GTTCATTTTATTTTGTAACTTGG - Intergenic
1169097926 20:2919898-2919920 AAGAATACTATTTTGTAACGTGG + Intronic
1169725438 20:8724124-8724146 GTGCAGATTATTTTGTCACCCGG - Intronic
1174785225 20:53426204-53426226 CTCCATTTTATTTTTTAACCAGG - Intronic
1177615075 21:23506626-23506648 ATGCATTTTGTTTTGTAAAGAGG - Intergenic
1179210018 21:39316505-39316527 GTGCATTTCATTTTGTAACAAGG + Intronic
1179401875 21:41091666-41091688 AAGCATATTATTATGTAAAAAGG - Intergenic
1182717119 22:32365993-32366015 GTGCAGATTATCTTGTCACCTGG - Intronic
949379200 3:3426281-3426303 GTACAGATTATTTTGTTACCCGG + Intergenic
950564264 3:13757108-13757130 GTACATATTATTTCGTCACCAGG + Intergenic
950884415 3:16350528-16350550 ATACATACTATTCTGTAAACAGG + Intronic
951269246 3:20604495-20604517 TGGCATATTATTTTAGAACCAGG + Intergenic
953816806 3:46164436-46164458 GTACAGATTATTTTGTCACCCGG + Intronic
954664161 3:52242478-52242500 ATGCATAATATTTTGACACAAGG + Intergenic
955192958 3:56778830-56778852 AAGAATAATATTTTGTAAGCGGG - Intronic
956462233 3:69484309-69484331 ATGCATTGTGTCTTGTAACCAGG - Intronic
956648808 3:71483922-71483944 AAGCTCATTTTTTTGTAACCGGG + Intronic
957315264 3:78568580-78568602 ATGCATATTATTTTACAGCGTGG + Intergenic
957751281 3:84420077-84420099 ATAAATATAATTTTGTTACCCGG + Intergenic
958414975 3:93862805-93862827 ATTTATATTATTCTGTATCCAGG - Intergenic
960051811 3:113246584-113246606 ATGCATTTTATTTAGTATCTGGG - Intronic
960217764 3:115063792-115063814 AAGCATATTATTTAGAAATCAGG - Intronic
960394585 3:117120585-117120607 ATGTGTATTATTTTGTATCCTGG - Intronic
962154022 3:132925030-132925052 ATTAATAGTATATTGTAACCTGG - Intergenic
963293968 3:143524549-143524571 ATGCATATTTTTTTGAAATAAGG + Intronic
963615924 3:147538054-147538076 ATGCAGATTATTTCATTACCCGG - Intergenic
963760926 3:149286552-149286574 ATGCATCTTTTTTTGTTTCCTGG - Intergenic
963883866 3:150557865-150557887 ATTCAAATTATTTTTTAGCCAGG + Intronic
963972933 3:151449442-151449464 ATGCATATTATGTTGTAGCAGGG - Intronic
965475536 3:169150412-169150434 TTGCAGATTAATTTGTAACTGGG - Intronic
970048203 4:11880247-11880269 AGGCATATTATTCTTTAACATGG - Intergenic
970105087 4:12573537-12573559 ACTCAGATTATTTTGGAACCAGG - Intergenic
971737099 4:30467618-30467640 ATACATTTTATTTTGTATCTTGG - Intergenic
971958948 4:33459401-33459423 GTACAGATTATTTTGTCACCAGG - Intergenic
972512766 4:39785116-39785138 AAGCATATTATTTAGTGACCTGG - Intergenic
972659734 4:41104564-41104586 ATGCAGATTATTTTGTACGCAGG + Intronic
973105002 4:46324654-46324676 GTGCAAATTATTTTGTCACCCGG + Intronic
973814647 4:54608003-54608025 GTACAGATTATTTTGTCACCTGG - Intergenic
974411526 4:61547349-61547371 ACACAGATTATTTTGTCACCGGG + Intronic
975163319 4:71148474-71148496 ATACAGATTATTTTGTCACCCGG + Intergenic
975430367 4:74282982-74283004 GTGCATTTTATTTTAAAACCTGG + Intronic
975821784 4:78278225-78278247 ATGCATCTGATTTTGTATTCAGG + Intronic
977084964 4:92583018-92583040 ATACATATTATTTTCTTATCTGG + Intronic
977108903 4:92925187-92925209 ATTCATTTTATTGTGTAATCTGG + Intronic
978100637 4:104836290-104836312 GTACAGATTATTTTGTCACCTGG + Intergenic
979339385 4:119503018-119503040 ATGCCTATTTATTTCTAACCAGG - Intronic
980398213 4:132243734-132243756 GTACAGATTATTTTGTTACCAGG - Intergenic
980669738 4:135988571-135988593 GTACAGATTATTTTGTCACCCGG - Intergenic
981430482 4:144652794-144652816 ATGCATTTTTTTTTCTTACCTGG - Exonic
982038616 4:151372558-151372580 ATGCATATTATTATGAAAGAAGG + Intergenic
982505566 4:156213142-156213164 GTACAGATTATTTTGTCACCTGG - Intergenic
983508418 4:168581039-168581061 ATACAGATTATTTTGTCACATGG - Intronic
983912152 4:173251929-173251951 ATCCAAATTATTTTTTAAACTGG + Intronic
987130131 5:14852599-14852621 GTACAGATTATTTTGTCACCTGG + Intronic
987564988 5:19573066-19573088 ATACATATTTTTTTGGAAACTGG - Intronic
987730888 5:21771102-21771124 ATACAGATTATTTTGTCACTAGG - Intronic
987793686 5:22601257-22601279 GTACAGATTATTTTGTCACCGGG + Intronic
988014673 5:25538740-25538762 ATTATTATTATTTTTTAACCTGG + Intergenic
988232065 5:28492091-28492113 GTACAGATTATTTTGTCACCAGG - Intergenic
989190406 5:38665165-38665187 ATGCATGTTATTTTGTAGAAAGG - Intergenic
990342024 5:54833261-54833283 ATACAGATTATTTTGTTAACTGG - Intergenic
990687043 5:58316320-58316342 GTACAGATTATTTTGTCACCCGG + Intergenic
992166036 5:74052811-74052833 ATGCATAGGATGTTGTAATCAGG + Intergenic
992915521 5:81448491-81448513 AAGCATATTACTGTGTAACTGGG + Intronic
993548023 5:89237342-89237364 ATGCAAAATATTTTATACCCCGG - Intergenic
995241329 5:109887853-109887875 TTGTATATCATTTTGGAACCTGG + Intergenic
996019276 5:118573943-118573965 GTACAGATTATTTTGTCACCTGG + Intergenic
996190841 5:120539574-120539596 ATGCAGATAATTTTGTCACCTGG - Intronic
996480034 5:123965445-123965467 CTGCATGTTATTTTTTAAACAGG + Intergenic
997497134 5:134337995-134338017 TTGCATATTATTTTGTATGAGGG - Intronic
997497140 5:134338037-134338059 ATGCATATTATTTTTTCCCTAGG - Intronic
999559054 5:152779576-152779598 TTGCATGTTATTCTGTGACCTGG - Intergenic
999803886 5:155063902-155063924 ATCCATATTATTTTGTTCACAGG - Intergenic
999871271 5:155753804-155753826 ATGCATATCAATGTGTATCCAGG - Intergenic
1000102429 5:158029162-158029184 CTGGATATTATTTTGTTTCCTGG - Intergenic
1001796171 5:174504120-174504142 ATGTATATTTTTGTGTAATCTGG + Intergenic
1002113801 5:176941149-176941171 CTACATAATATTTGGTAACCTGG - Intronic
1003044652 6:2722648-2722670 ATGCATATTATTTAGACACATGG + Intronic
1004538942 6:16530665-16530687 TTACAGATTATTTTGTCACCAGG - Intronic
1004854928 6:19739639-19739661 ATGCAAATTACTTTGAATCCAGG + Intergenic
1004855079 6:19741332-19741354 AAGCATGTTATTTTGGAACATGG - Intergenic
1008422088 6:51312945-51312967 ATGGATATTATTTTGTTATGAGG + Intergenic
1008571113 6:52817499-52817521 GTGCATTTTGTTTTATAACCTGG + Intergenic
1008577089 6:52871115-52871137 GTGCATTTTATTTCATAACCTGG + Intronic
1008578823 6:52886733-52886755 GTGCATTTTGTTTTATAACCTGG + Intronic
1008722948 6:54379530-54379552 ATACATATTATTTTATAAAGTGG - Intronic
1008823313 6:55660295-55660317 GTGCAGATTATTTTGTCACCCGG + Intergenic
1008951143 6:57160873-57160895 ATGCATATGATTTTCAAAACAGG + Intronic
1009365308 6:62853274-62853296 ATGGATATTAGTTTCTAACGTGG - Intergenic
1010197085 6:73250819-73250841 ATGCTTAATATTCTGTAACTTGG - Intronic
1010347889 6:74834405-74834427 ATGTATATCATTTTGTGATCTGG - Intergenic
1011389710 6:86838338-86838360 ATTGAGATTAATTTGTAACCTGG - Intergenic
1012293626 6:97491615-97491637 TTGCATTTTTTTTTGTAACATGG + Intergenic
1013857956 6:114597464-114597486 ATGCATTTTATTTAATAACTAGG - Intergenic
1015088202 6:129321743-129321765 ATACATCTTATTTTGTAAATAGG + Intronic
1015482239 6:133725171-133725193 ATGAATATGCTTTTGTAACCTGG + Intergenic
1016763618 6:147767897-147767919 AAGCATATTATTTAGAAACATGG + Intergenic
1017081372 6:150672125-150672147 CTGCATATTTTTTTGTGTCCTGG - Intronic
1017338785 6:153295134-153295156 GTACAGATTATTTTGTCACCTGG + Intergenic
1017711423 6:157171917-157171939 ATGAATATTATTTTGAAGGCAGG - Intronic
1017944597 6:159084398-159084420 GTGTATAATATTTTATAACCTGG + Intergenic
1018184076 6:161250255-161250277 GTACAGATTATTTTGTCACCAGG - Intronic
1018757324 6:166861774-166861796 ATGCAGATTAGTTTGGAAACGGG + Intronic
1018943163 6:168324038-168324060 ATACAGATTATTTTGTCACCCGG + Intergenic
1019996850 7:4730139-4730161 ATGCATCTATTTTTGTAATCAGG - Intronic
1020969747 7:14921030-14921052 GTACAGATTATTTTGTCACCTGG + Intronic
1021261377 7:18461477-18461499 ATGTTTATAATATTGTAACCTGG + Intronic
1023115511 7:36858106-36858128 ATGCTTACTATTTTGAAAACTGG + Intronic
1023139506 7:37086941-37086963 TTGCATATTGTTTTCTAACCAGG + Intronic
1024102475 7:46046739-46046761 TGGCATAGTATTTTATAACCAGG - Intergenic
1024128755 7:46327798-46327820 GTACAGATTATTTTGTCACCTGG - Intergenic
1024421482 7:49172156-49172178 ATACATTTTATGTTGTAAGCAGG + Intergenic
1026510836 7:71026276-71026298 GTGCAGACTATTTTGTCACCTGG - Intergenic
1027674221 7:81139955-81139977 ATGCATGTTATTTTTCCACCAGG - Intergenic
1027847095 7:83394102-83394124 ATGCTTAATATTTTGTTAACAGG + Intronic
1028614983 7:92755875-92755897 ATGCATAGAATTTTTAAACCGGG - Intronic
1029325020 7:99799407-99799429 GTGCAGATAATTTTGTCACCGGG - Intergenic
1030586752 7:111430353-111430375 ATGCTTTTTATTTTTTTACCAGG - Intronic
1030614748 7:111728217-111728239 ATACTTCTTATTTTGTAAACGGG + Exonic
1031096029 7:117421814-117421836 ATGGAAATTATTTAGTAACAAGG + Intronic
1031257295 7:119470211-119470233 ATTCAGATTCTTTTATAACCTGG + Intergenic
1031539157 7:122972201-122972223 ATGCAGATCAACTTGTAACCTGG + Intergenic
1031721659 7:125184208-125184230 ATGTATATAATTATATAACCTGG + Intergenic
1033020626 7:137720917-137720939 ATACATAAAATTTTGTAACAGGG - Intronic
1033336404 7:140456532-140456554 ATGCATTTTATCTTGAAACTGGG - Intronic
1033769615 7:144535089-144535111 ATACAGATTATTTTATCACCTGG + Intronic
1036115131 8:5951066-5951088 TTGCTTATTATTTAGTAACCTGG - Intergenic
1036585847 8:10122611-10122633 GTACAGATTATTTTGTCACCCGG + Intronic
1037698945 8:21254593-21254615 ATGCAAAATGATTTGTAACCTGG - Intergenic
1038831383 8:31065316-31065338 ATACAGATTATTTTATCACCCGG + Intronic
1038943498 8:32331559-32331581 ATGCATATTAAATTGTAAAGGGG - Intronic
1039012864 8:33114248-33114270 GTACAGATTATTTTGTCACCCGG - Intergenic
1041846905 8:62339761-62339783 ATGCACATTACTTTTTAACTTGG - Intronic
1042974934 8:74458223-74458245 ATGAAGATTATTTTATAACATGG + Intronic
1042976150 8:74472022-74472044 GTACAGATTATTTTGTCACCAGG + Intronic
1043001560 8:74766250-74766272 GTACAGATTATTTTGTCACCCGG - Intronic
1043079558 8:75749039-75749061 TTGCTTATTTTTTTTTAACCAGG - Intergenic
1043092183 8:75919034-75919056 ATATATATTTTTATGTAACCTGG + Intergenic
1044190185 8:89306806-89306828 ATGCCTATTATTCAGTAACACGG + Intergenic
1045208891 8:100074341-100074363 ATGCATATAATCATGTAACCAGG + Intronic
1046161519 8:110373107-110373129 ATGCATATTATTGTGACACATGG + Intergenic
1047120385 8:121897020-121897042 GTGAATATTATTTTGCAAACAGG - Intergenic
1048355138 8:133647354-133647376 CAGCTTATTATTTTGTATCCAGG - Intergenic
1048775432 8:137940688-137940710 ATGCATTATTTTGTGTAACCAGG + Intergenic
1050076608 9:1872284-1872306 ATGCATATTCTTTTCAAACATGG + Intergenic
1050249128 9:3725368-3725390 GTACAGATTATTTTGTCACCAGG - Intergenic
1050513165 9:6415048-6415070 ATGCATTTTATTTTCTAGCTGGG + Intronic
1051017972 9:12504133-12504155 ATGCATATTAATTTATTAACAGG + Intergenic
1051817856 9:21130893-21130915 ATGCATATTAATTTGAATGCAGG - Intergenic
1052272975 9:26646396-26646418 GTGAATAATATTTTATAACCTGG - Intergenic
1053649974 9:40157614-40157636 ATGGATATTATTTGGAAAGCTGG - Intergenic
1053755766 9:41306314-41306336 ATGGATATTATTTGGAAAGCTGG + Intergenic
1054330482 9:63749371-63749393 ATGGATATTATTTGGAAAGCTGG - Intergenic
1054534607 9:66218589-66218611 ATGGATATTATTTGGAAAGCTGG + Intergenic
1054725447 9:68645581-68645603 TTCCATATTATTTTGTAATATGG - Intergenic
1059084257 9:111283267-111283289 ATGCATATCAATCTGTTACCTGG + Intergenic
1060034850 9:120246191-120246213 ATACAGATTATTTTGTCACCTGG + Intergenic
1060246998 9:121955239-121955261 ATGCATTTTATTTTTTAAGATGG - Intronic
1186328236 X:8503084-8503106 ATGTATATTATTTTTTAACCTGG - Intergenic
1187545296 X:20245778-20245800 AAGTATATTATTTTTTAAACAGG + Intronic
1187882135 X:23857150-23857172 GTACAGATTATTTTGTTACCCGG - Intronic
1188014187 X:25090003-25090025 GTACAGATTATTTTGTCACCTGG + Intergenic
1188290788 X:28385788-28385810 ATGCATATTTTTGTGTGTCCAGG - Intergenic
1188334082 X:28906948-28906970 ATGCATATTATTTTTTATGTGGG + Intronic
1189252462 X:39611960-39611982 GAGCATATTATTTTGTATCCAGG - Intergenic
1189402873 X:40688642-40688664 ATGCCTAATATGTTGTAACTTGG - Intronic
1189530019 X:41870350-41870372 ATCCAAATAATTTTATAACCAGG + Intronic
1189800171 X:44684608-44684630 AAGAATATTATTTTGTGACATGG + Intergenic
1192044119 X:67654057-67654079 ATGCATAATATTTGGGAAACAGG + Intronic
1193340525 X:80343877-80343899 ATACAAATTATTTTGTTACCTGG + Intronic
1193562682 X:83038216-83038238 AAGCATATTATTTTGCCTCCAGG + Intergenic
1194074310 X:89369508-89369530 ATATATATATTTTTGTAACCTGG - Intergenic
1194222241 X:91208035-91208057 ATGCATATAATTTTGTTTCTTGG + Intergenic
1195270659 X:103226352-103226374 GTACAGATTATTTTGTCACCTGG - Intergenic
1195775626 X:108401652-108401674 AGGTATATTATTTTGTAATCAGG + Intronic
1196033333 X:111115191-111115213 ATGCTTATTATTTTACTACCTGG - Intronic
1197060650 X:122176337-122176359 GTGCATGTTGTTTTGTAAACAGG + Intergenic
1197575501 X:128205989-128206011 GTACAGATTATTTTGTTACCAGG - Intergenic
1198134131 X:133729741-133729763 ATGAAGATTCTTTTGTTACCTGG - Intronic
1198151012 X:133909758-133909780 ATGCATATTATTTTTTCATGGGG + Intronic
1198945449 X:142008090-142008112 GTACAGATTATTTTGTCACCCGG + Intergenic
1200558761 Y:4671810-4671832 ATGCATATAATTTTGTTTCTTGG + Intergenic
1200729703 Y:6721035-6721057 ATATATATATTTTTGTAACCTGG - Intergenic
1201711010 Y:16991941-16991963 GTACAGATTATTTTGTCACCCGG + Intergenic
1201932403 Y:19365494-19365516 GTACAAATTATTTTGTAACCAGG - Intergenic
1201983814 Y:19939210-19939232 GTACAGATTATTTTGTCACCAGG + Intergenic
1202056121 Y:20832509-20832531 GTACAGATTATTTTGTCACCAGG + Intergenic