ID: 906988071

View in Genome Browser
Species Human (GRCh38)
Location 1:50708189-50708211
Sequence GCCACAGTGAGCAAAGACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 327}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906988071 Original CRISPR GCCACAGTGAGCAAAGACTG GGG Intronic
900515854 1:3081938-3081960 GCCACAGTGTGCCAAGGCAGCGG + Intronic
901294969 1:8154172-8154194 GCCACAGAGCGCAAAGGCCGGGG - Intergenic
901342482 1:8507799-8507821 GTTGCAGTGAGCCAAGACTGTGG - Intronic
901877237 1:12173837-12173859 GCCACAGTGGAAAAAGACTGTGG - Intronic
903228812 1:21909648-21909670 GCTACAGTGATCAAAGATTCAGG + Intronic
903366098 1:22806328-22806350 GGTACAGTGAGCACAGACTCTGG - Intronic
904285272 1:29449864-29449886 GCCACAATGAGCACAGACTCTGG - Intergenic
904508403 1:30979260-30979282 ACCACAGTGACCAAAGACAGGGG + Intronic
906988071 1:50708189-50708211 GCCACAGTGAGCAAAGACTGGGG + Intronic
907529166 1:55075905-55075927 GCTACAGTGAGCTACGACTGTGG + Intronic
908311889 1:62892373-62892395 GCCACAGTACGCAAACATTGCGG - Intergenic
909392062 1:75130513-75130535 CCCACTGTGGGCCAAGACTGAGG - Exonic
909571722 1:77120274-77120296 GCTACAGTGAGCTGAGATTGTGG - Intronic
910737928 1:90482691-90482713 GGCAAAGTGGGCAAAGGCTGGGG - Intergenic
911017709 1:93352129-93352151 GCCACAGTAAACTATGACTGTGG - Intronic
911076825 1:93883879-93883901 TCAACAGTGAGCAAAGAAAGAGG + Intergenic
911730754 1:101290120-101290142 TCCACAGTAAGCAAAGCATGGGG + Intergenic
912104220 1:106250413-106250435 TACACAGTGTGCAAACACTGTGG + Intergenic
912385296 1:109268453-109268475 GCAACAGTGAGCACAGAGGGAGG + Intronic
912429230 1:109620423-109620445 GCCAGAGTGTGCAGAGACAGAGG + Intronic
912490497 1:110060202-110060224 GCCAAGGTCAGCATAGACTGAGG - Exonic
915124917 1:153657208-153657230 GCTACAGTGAGCCAAGATCGTGG - Intergenic
915125051 1:153658071-153658093 GCTACAGTGAGCCAAGACGGTGG + Intergenic
916588834 1:166170662-166170684 GCCACATTAAGAAAAGAGTGGGG - Intergenic
916818060 1:168372360-168372382 GCCACAGTGAGGGAAGACCTGGG + Intergenic
917136054 1:171789001-171789023 GCCACAGTGACCAAACAATAGGG - Intronic
917499500 1:175573571-175573593 TGCAAAGTGGGCAAAGACTGTGG + Intronic
919426950 1:197444988-197445010 GTCACTGTGAGTAAACACTGTGG + Intronic
919740188 1:200976709-200976731 GCAACAGAGGGCAAAGATTGGGG + Intronic
919952973 1:202382812-202382834 GTTACAGTGAGCCAAGACTGTGG + Intronic
920523623 1:206648627-206648649 CCCCCAGGCAGCAAAGACTGGGG + Exonic
921630577 1:217429019-217429041 GCCACTGAGAGCAAACAATGAGG - Exonic
922523186 1:226275629-226275651 GCTGCAGTGAGCCGAGACTGAGG + Intronic
922947211 1:229526834-229526856 GGAAAAGTGAGCAAAGACTATGG - Intronic
923103424 1:230835857-230835879 GACACAGACAGCACAGACTGAGG + Intergenic
924194160 1:241587517-241587539 GTTGCAGTGAGCCAAGACTGAGG - Intronic
924224049 1:241906291-241906313 GCTACAGTGAGCCAAGATTGAGG + Intergenic
924623591 1:245683087-245683109 GCCTCAGGGAGGGAAGACTGTGG - Intronic
924756161 1:246943134-246943156 GTTACAGTGAGCCGAGACTGCGG - Intergenic
1062830112 10:599880-599902 CCCACACTGAGCAGAGACTGGGG - Intronic
1063961471 10:11309622-11309644 GCCACAGTCAGAGCAGACTGTGG - Intronic
1066504993 10:36032124-36032146 GAGACAGTGAGCAAAGACAGAGG - Intergenic
1067346580 10:45442653-45442675 GTCACTGAGAGCAATGACTGAGG + Intronic
1070302837 10:75217193-75217215 GCTGCAGTGAGCTATGACTGTGG + Intronic
1070951578 10:80435542-80435564 GCTGCAGTGAGCCATGACTGGGG - Exonic
1074278424 10:112026928-112026950 GCCTCAGTGCACAGAGACTGAGG + Intergenic
1075095910 10:119470744-119470766 GCTGCAGTGAGCCATGACTGCGG + Intergenic
1076894411 10:133302795-133302817 GGCACTGTGAGCAGAGACAGTGG + Exonic
1077003067 11:334738-334760 GCCACAGGCAGCAAAAACTCCGG - Intergenic
1077083112 11:734405-734427 GTTGCAGTGAGCCAAGACTGCGG + Intergenic
1077546784 11:3175269-3175291 GCCACAGTGTGCCAGGCCTGGGG - Intergenic
1078918236 11:15801099-15801121 GCTACACTCAGCAAAGGCTGAGG - Intergenic
1079059151 11:17232748-17232770 GTTGCAGTGAGCCAAGACTGCGG - Intronic
1079107407 11:17580244-17580266 GGCACAATGAGCACAGACTCAGG + Intronic
1079338468 11:19591951-19591973 GCCACAATGAGCAAAAGCTAAGG + Intronic
1079377820 11:19909538-19909560 CCCTCAGTGAGCAAAGACCCTGG + Intronic
1079693988 11:23455799-23455821 GCCACACTGAGCAAAGAGAGTGG + Intergenic
1081692623 11:45088505-45088527 GCCACACTAAGCACAGCCTGGGG + Intergenic
1081760153 11:45571332-45571354 GCCAAAGTCAGCAAAGCCTCTGG - Intergenic
1081977762 11:47246512-47246534 GCTGCAGTGAGCTATGACTGAGG + Intronic
1083160682 11:60852433-60852455 GCCGCAGTGATCAAAGTCCGAGG - Exonic
1083475596 11:62913021-62913043 GACAGAATGAGCAAGGACTGTGG + Intronic
1087689896 11:101308519-101308541 GGTACAGAGAGGAAAGACTGTGG - Intergenic
1087917620 11:103829567-103829589 GCCCCAGGCAGCAAATACTGAGG - Intergenic
1089183762 11:116600903-116600925 GCTGCAGTGAGCCAAGATTGTGG + Intergenic
1091989058 12:4939848-4939870 GCCAGAGTGAGAAAATATTGGGG - Intergenic
1092312600 12:7374575-7374597 CCCAAAGTGAGCAGAGACCGTGG + Exonic
1093460409 12:19402661-19402683 GGCTCAGTGAGGAAAGTCTGTGG - Intergenic
1094691523 12:32774333-32774355 GTTACAGTGAGCCAAGATTGTGG - Intergenic
1098259354 12:68652382-68652404 GTTGCAGTGAGCCAAGACTGTGG + Intronic
1100980042 12:100156589-100156611 GCCACTGTCAGCAAAACCTGGGG - Intergenic
1101122548 12:101598079-101598101 GCTGCAGTGAGCGGAGACTGTGG - Intronic
1102097797 12:110254185-110254207 GTTGCAGTGAGCCAAGACTGTGG + Intergenic
1103122905 12:118395751-118395773 GGTACAGTGAGCCAAGACCGTGG - Intronic
1103345623 12:120248222-120248244 TCTACCGTGAGCAAAGGCTGGGG - Intronic
1103762579 12:123262313-123262335 ACCACAGAGACAAAAGACTGGGG - Intronic
1105810763 13:23993166-23993188 GCCACAGTGGGCCAAGCCTTGGG - Intronic
1106009705 13:25808189-25808211 GCTTCAGTGAGCTATGACTGTGG - Intronic
1106488100 13:30190352-30190374 GCCAGAGAGAGAAAAGATTGGGG + Intergenic
1106656659 13:31753906-31753928 GCCACAGAGAGAAAAGGGTGGGG + Intronic
1106734894 13:32578672-32578694 GCCAGAATGAGTAAAGACTTTGG + Intergenic
1108251592 13:48573186-48573208 GGCTCAGTCAGCAAACACTGAGG + Intergenic
1108589340 13:51898154-51898176 GCTGCAGTAAGCAGAGACTGTGG + Intergenic
1109434863 13:62285633-62285655 GTTACAGTGAGCAGAGATTGTGG - Intergenic
1110826152 13:79974393-79974415 GCCACAGTCAGAGAAGGCTGTGG + Intergenic
1112395154 13:99022885-99022907 GCCGCATTGAGCTATGACTGTGG + Intronic
1114709877 14:24767452-24767474 AGCACTGTGAGCAAATACTGGGG - Intergenic
1115821671 14:37219196-37219218 GCTACAGTGATCAAAGATGGAGG + Intronic
1115936620 14:38559850-38559872 GATACAGTGAGCAATGTCTGAGG + Intergenic
1116079358 14:40154057-40154079 GCCACAGTAAGAAAAGGCAGTGG + Intergenic
1116278812 14:42874184-42874206 CCCCCAGTGAGCAAATTCTGTGG + Intergenic
1116709796 14:48353358-48353380 TCCTGAGTGAGAAAAGACTGTGG - Intergenic
1117908112 14:60611362-60611384 GCCACAATGAGTTAAGACTTTGG - Intergenic
1119015252 14:71044642-71044664 ACCACAGTGACCAAAGCCAGCGG + Intronic
1119171820 14:72541427-72541449 GCCACAGAGAGGGAAGACCGAGG - Intronic
1119530939 14:75361023-75361045 GCTGCAGTGAGCCAAGATTGTGG - Intergenic
1119666813 14:76490881-76490903 GCCCCAGTGACCATAGCCTGGGG - Intronic
1119861960 14:77942421-77942443 GCTACAATGAGCAAGGACAGAGG - Intergenic
1121982542 14:98467459-98467481 GGCACAGGGAGGAAAGACTTGGG - Intergenic
1122915529 14:104856647-104856669 TCCACAGCGAGCAAAGACCGTGG - Intergenic
1123830050 15:24126666-24126688 GTCAAAGTGAGCAAAGACTCTGG - Intergenic
1123844955 15:24290607-24290629 GTCAAAGTGAGCAAAGACTCTGG - Intergenic
1123860107 15:24457284-24457306 GTCAAAGTGAGCAAAGACTCTGG - Intergenic
1124371976 15:29109194-29109216 CCCACAGTCAGGAAAGACAGTGG + Intronic
1125518673 15:40336604-40336626 GCCACAGGCAGCAAAGCCCGGGG - Exonic
1125791579 15:42370593-42370615 GCCACAGAGAGGAAGAACTGGGG + Intronic
1125894956 15:43293987-43294009 GCCACAATGATCAAGGATTGGGG + Intronic
1126559762 15:50030491-50030513 GCTACACTGAGCACAGAATGGGG + Intronic
1127235201 15:57042473-57042495 GTCACAGTGAGCAATGACTGTGG - Intronic
1129321365 15:74776912-74776934 CCCACAGATAGCAAAGACTCAGG - Intergenic
1129514143 15:76146666-76146688 ATGCCAGTGAGCAAAGACTGGGG + Intronic
1130682806 15:86011108-86011130 GCCAAAGTGAGCCAAGATTGAGG + Intergenic
1131281621 15:91025774-91025796 GCCACTGTCAGCAAAACCTGGGG - Intergenic
1132387371 15:101409992-101410014 GCTGCAGTGAGCAATGATTGTGG - Intronic
1133020770 16:2966053-2966075 GCCACTTTGAGCATAGGCTGCGG + Intronic
1133914041 16:10092898-10092920 GCTGCAGTGAGCCAAGATTGTGG - Intronic
1133983490 16:10650821-10650843 GTTACAGTGAGCAGAGATTGTGG + Intronic
1135760396 16:25133458-25133480 GCTGCAGTGAGCCAAGATTGTGG - Intronic
1136462378 16:30419508-30419530 GCTACAGTGAGCTAATATTGTGG + Intronic
1137865593 16:51892796-51892818 GTCCCAGTGAGCAAAGAAGGTGG - Intergenic
1138111026 16:54324062-54324084 GCCATAGTGAGCTATGATTGGGG - Intergenic
1138291628 16:55852997-55853019 GCCACAAGGTGCAAATACTGAGG + Exonic
1138656139 16:58492601-58492623 GCTGCAGTGAGCTAAGATTGTGG - Intronic
1139124278 16:64058831-64058853 GCCGGAATGAGCAAAGACTGTGG - Intergenic
1139929021 16:70510382-70510404 GCCACAGTGAACTATGACTGTGG - Intronic
1139934538 16:70559623-70559645 GCTGCAGTGAGCCAAGATTGTGG + Intronic
1140846462 16:78893284-78893306 GCCACAGTAAGCACAGAGTCAGG + Intronic
1140868570 16:79086008-79086030 GCTGCAGTGAGCCATGACTGTGG + Intronic
1141874339 16:86812275-86812297 CCCCCTGTGGGCAAAGACTGTGG - Intergenic
1142929013 17:3266591-3266613 TCCACCGTGAGCAAGGCCTGTGG + Intergenic
1145279257 17:21456091-21456113 GGCAGAGAGACCAAAGACTGAGG + Intergenic
1146224765 17:31055929-31055951 TGCACAGTGAGAAAAGGCTGTGG - Intergenic
1146823848 17:36006671-36006693 GCCTAAGTGAGAAGAGACTGAGG - Intergenic
1147147030 17:38491345-38491367 GCCAGAGTGAGGGAGGACTGAGG + Intronic
1147382970 17:40066314-40066336 GCTACAGAGGGGAAAGACTGAGG + Intronic
1147703720 17:42411927-42411949 TCCACAGTGGGCAGTGACTGGGG + Intronic
1147910205 17:43851519-43851541 CACACAGTCAGCAAGGACTGGGG + Intronic
1148466191 17:47866612-47866634 GCCACCGTGAACAAAGGCTCTGG + Intergenic
1150154029 17:62835533-62835555 GTTACAGTGAGCCAAGATTGTGG + Intergenic
1150248016 17:63690556-63690578 GCCACAGGGTGAAAGGACTGTGG + Intronic
1151387920 17:73766573-73766595 GAGAGAGTGAGCAAAGGCTGGGG + Intergenic
1152913638 17:83020511-83020533 GCCACAAGGACCAAAGACCGAGG + Intronic
1155608804 18:27639079-27639101 CCCACAGTGAAGAAGGACTGAGG + Intergenic
1155737816 18:29245910-29245932 ACCTCAGTGAGAATAGACTGGGG - Intergenic
1156118069 18:33811178-33811200 GCCACAGTGAATAAAGAAAGTGG + Intergenic
1157550719 18:48580194-48580216 GCCACAGTAACCACAGACTCTGG - Intronic
1157621472 18:49019411-49019433 GCCAGAGAGGACAAAGACTGTGG - Intergenic
1158382294 18:56945841-56945863 GCCACAGAGAACAATGACTCAGG - Intronic
1161418537 19:4162066-4162088 GCTACAGTGAGCCGAGACTGTGG - Intronic
1161623715 19:5313313-5313335 GGCAAAGTGAGCAGAGACAGGGG + Intronic
1162574768 19:11492805-11492827 GCTGCAGTGAGCCAAGACTAGGG - Intronic
1165567598 19:36744562-36744584 GCTGCAGTGAGCCAAGATTGTGG + Exonic
1165569929 19:36767173-36767195 GTTACAGTGAGCCAAGACCGTGG + Intronic
1165731113 19:38145469-38145491 GTTGCAGTGAGCCAAGACTGTGG + Intronic
1165901575 19:39171801-39171823 GCCACAGTGAGCTGAGAACGTGG - Intronic
1166784663 19:45360437-45360459 GTTACAGTGAGCCAAGATTGTGG - Intronic
1167551203 19:50162219-50162241 GCTCCAGTGAGCAGAGATTGTGG + Intronic
1167592551 19:50412212-50412234 GTCGCAGTGAGCCAAGATTGTGG - Intronic
1167714233 19:51130885-51130907 TCCCCAGTGTGCAAGGACTGAGG - Intronic
1168025394 19:53640108-53640130 GACACAGTGGGGAATGACTGGGG - Intergenic
1168278843 19:55292944-55292966 GCTGCAGTGAGCTATGACTGTGG + Intronic
1168367950 19:55805599-55805621 GCCACGGTGAGCTGAGATTGTGG - Intronic
925314364 2:2909746-2909768 GCCACACTGAGCCAAGGCTGAGG + Intergenic
925851186 2:8083720-8083742 GCCACAGTCAGAAAAACCTGTGG - Intergenic
927640143 2:24840890-24840912 GTCACGGTGAGAAAACACTGAGG + Intronic
927914128 2:26923720-26923742 GTCGCAGTGAGCCAAGAATGCGG - Intronic
928253801 2:29704752-29704774 GCCACAGTGAGAACAGGGTGGGG + Intronic
929242387 2:39666013-39666035 GCCCCAGGGAGCACAGGCTGAGG - Exonic
931820519 2:65946932-65946954 TCAACAGTGAGTAATGACTGTGG - Intergenic
932466920 2:71930024-71930046 TCCACAATAAACAAAGACTGGGG - Intergenic
934717428 2:96551886-96551908 CCCACAGTGGGAAGAGACTGCGG + Exonic
934718104 2:96554792-96554814 TCCTCAGTGAGCAGAGACTGAGG + Intergenic
935280784 2:101516019-101516041 GCCACAGTGATCAGGGACTCGGG + Intergenic
935531767 2:104241293-104241315 TCCCAAGTGAGCAAAAACTGAGG + Intergenic
935695333 2:105766383-105766405 GCCACAGTGAGCCATGATGGCGG - Intronic
936520837 2:113211265-113211287 GCCACAGTTAGTATAGGCTGGGG - Intergenic
937868595 2:126771785-126771807 GCCACAGGGAGCACAGAGTAGGG + Intergenic
938410741 2:131061718-131061740 GTTGCAGTGAGCAGAGACTGCGG + Intronic
938907858 2:135855602-135855624 GCTGCAGTGAGCTATGACTGTGG + Intronic
943369995 2:187003674-187003696 GCCTCTGTGTGTAAAGACTGTGG - Intergenic
943399316 2:187385810-187385832 GCTGCAGTGAGCCAAGATTGTGG - Intronic
944804825 2:203270763-203270785 GCTGCAGTGAGCTGAGACTGAGG - Intronic
945116952 2:206417308-206417330 GCCACAGTGAGCCAGGTCTGAGG - Intergenic
945194800 2:207227900-207227922 GGCACAGTGAGAAGAAACTGAGG + Intergenic
945497827 2:210531222-210531244 GCCATAGAGGGCAAAGACGGGGG + Intronic
946573066 2:221045416-221045438 GCCACAGTGAGAATACACCGTGG + Intergenic
948972121 2:241436922-241436944 GCTACAGTGAGCCAAGATAGTGG + Intronic
1169014457 20:2280272-2280294 GCCACTCTGAGCATAAACTGTGG + Intergenic
1171096101 20:22333505-22333527 CTCACAGTGGGCAAAGACAGTGG - Intergenic
1172279793 20:33700847-33700869 GCCGCAGTGAGCCGAGACGGCGG - Intergenic
1173502706 20:43565610-43565632 CCCACAGTGGGCCAAGACTAAGG + Intronic
1173907827 20:46641685-46641707 GGCACAGTGAGAAAAGACAAGGG + Intronic
1174438255 20:50527403-50527425 GTTGCAGTGAGCCAAGACTGCGG - Intronic
1175159452 20:56997031-56997053 GCCAGAGGGAGCGCAGACTGAGG + Intergenic
1175991608 20:62792685-62792707 GCAACAGGGATCAAAGAGTGAGG + Intergenic
1176302420 21:5104902-5104924 GCCACCCTGAGTAAAGACGGGGG + Intergenic
1176364499 21:6024586-6024608 GCTTCAGTGAGCTATGACTGTGG - Intergenic
1178144066 21:29717749-29717771 GCCAGAATGAGCTAAGACTTTGG + Intronic
1178439880 21:32590176-32590198 GCCGCAGTGAGCTGAGATTGTGG + Intronic
1178614176 21:34116067-34116089 GCTGCAGTGAGCCATGACTGTGG - Intronic
1178669435 21:34577945-34577967 GACACAGTGTGAAAAGTCTGCGG + Intronic
1178998949 21:37436331-37436353 GTCACAGTGATCAAGGACTCCGG + Intronic
1179759019 21:43513959-43513981 GCTTCAGTGAGCTATGACTGTGG + Intergenic
1179854607 21:44157021-44157043 GCCACCCTGAGTAAAGACGGGGG - Intergenic
1180997724 22:19973753-19973775 GCCACAGTGCGCAAAGAGCGCGG - Exonic
1181758803 22:25043597-25043619 GCCATTGTGATCCAAGACTGGGG + Intronic
1182082906 22:27542045-27542067 GCCACATTGAGCAGTGACGGCGG - Intergenic
1182540527 22:31038362-31038384 GCTACAGTAAGCTATGACTGAGG - Intergenic
1183453195 22:37907405-37907427 GGCAGAGAGAGCAAAGACAGAGG - Intronic
1183770435 22:39920608-39920630 GTCACAGTCAGCACAGAATGGGG - Intronic
1184191323 22:42896996-42897018 GCCACAGTGAGCCATGATTGTGG - Intronic
951513318 3:23528753-23528775 GGCAGAGTGAGCAATCACTGGGG + Intronic
952198961 3:31105481-31105503 TTCACAGTCATCAAAGACTGAGG + Intergenic
954255571 3:49403274-49403296 GCTGCAGTGAGCCAAGATTGCGG + Intronic
954278473 3:49558256-49558278 GGGACAGTGAGCAGAGAATGAGG + Intronic
954453201 3:50582825-50582847 GCCATAGTGAGGAGAGGCTGAGG - Exonic
954791436 3:53136174-53136196 GCCTGAGTGAGCAGTGACTGTGG - Intergenic
955877461 3:63507500-63507522 GCCACAGTCATAAAAGACTGGGG + Intronic
956549631 3:70442983-70443005 GCTACAGTGACCAAAGACTTAGG + Intergenic
957175920 3:76809385-76809407 GCCACAGTGTGAGAAGACTATGG - Intronic
960600807 3:119456666-119456688 ACTACAGTGAGCTAAGATTGTGG - Intronic
960718607 3:120603303-120603325 GCCCCAGAAAGCAGAGACTGAGG + Intergenic
961811770 3:129526140-129526162 GCTACAGTGAGCTATGATTGTGG + Intergenic
962542321 3:136395048-136395070 GCCACAGTGAGCCGTGACAGTGG + Intronic
962822510 3:139065221-139065243 GCCACAGTGAGCCATGATTATGG + Intronic
962948600 3:140197153-140197175 GCAGCAGTGAGCTGAGACTGTGG - Intronic
966955214 3:184869825-184869847 GCTACAGTGAGCTATGATTGCGG + Intronic
969293763 4:6257037-6257059 GTCGCAGTGAGCCAAGATTGCGG + Intergenic
969665343 4:8554183-8554205 GCAAGAGTGAGCCATGACTGTGG + Intergenic
972197775 4:36675013-36675035 GCCACAGTGGGCAACGACGCAGG + Intergenic
972339886 4:38142934-38142956 ACCACACTGTGCAAAGACAGTGG - Intergenic
972903314 4:43712386-43712408 CCCACAGTGAGTAGAGAGTGGGG + Intergenic
973303721 4:48619219-48619241 GGCACAGTAAGCAAAGAATAAGG + Intronic
974606248 4:64156130-64156152 GCCAAAATGAGCTAAGACTTTGG - Intergenic
975292151 4:72689402-72689424 GCCACAGTGGGAAAAGAAGGGGG + Intergenic
975450666 4:74521961-74521983 GCAACAGTGGGCAGAAACTGAGG - Intergenic
975561621 4:75713725-75713747 GTCACAGTGAGCTATGAATGGGG + Intronic
975607255 4:76167741-76167763 GTCACAGTGAGCCAAGATGGTGG - Intronic
976142286 4:82004647-82004669 GTCAGAGTGTGCAAAGACAGGGG + Intronic
976631797 4:87245727-87245749 GCTGCAGTGAGCCAAGATTGTGG + Intergenic
977014011 4:91669893-91669915 GCCAGAGTGAGTTAAGACTTTGG - Intergenic
977253344 4:94712953-94712975 GCTACAGTGAGCTATGATTGGGG + Intergenic
979162729 4:117484421-117484443 GACACAGAGAACAAAGCCTGAGG + Intergenic
979968000 4:127099205-127099227 GCTACAGTGAGCAGTGATTGCGG - Intergenic
980204749 4:129702859-129702881 GCGAACGTGAGCAAAGAGTGGGG - Intergenic
981712054 4:147719104-147719126 GTGACAGTGAGCTAAGATTGAGG + Intergenic
981751081 4:148092789-148092811 ACCACAGTGAGCAGAGAATGGGG - Intronic
981913304 4:150007512-150007534 GCCACTGTGGGAAAAGACAGAGG - Intergenic
982678790 4:158405851-158405873 GTTGCAGTGAGCAAAGATTGTGG - Intronic
983734400 4:171039732-171039754 GCCACAGAGAGCCAAAACTCTGG - Intergenic
985527929 5:416469-416491 GGCACACTCAGCAAAGCCTGTGG - Intronic
985986802 5:3522821-3522843 GCCACAGTAAGAAAATACAGGGG + Intergenic
986221701 5:5774483-5774505 GCCACAGGGAGCAAACACACAGG - Intergenic
986758921 5:10862297-10862319 TCCACAGGGAGCTAAGACAGTGG - Intergenic
987304908 5:16628382-16628404 CCCACTGGGAGAAAAGACTGTGG + Intergenic
987623228 5:20363775-20363797 GCCACACAGAGCAATGAATGGGG - Intronic
987630008 5:20458177-20458199 GCTGCAGTGAGCTATGACTGTGG - Intronic
988503614 5:31803157-31803179 GCTGCAGTGAGCTATGACTGTGG - Intronic
988550175 5:32193716-32193738 GCCACAGTGAGCAGAGGTGGCGG - Intergenic
990571786 5:57086214-57086236 GCTACAGTGAGCCAAGATTGTGG - Intergenic
991603384 5:68375780-68375802 GCAAAAGTGAGGAAAGACTTTGG + Intergenic
992618536 5:78569752-78569774 ACCACAGTGGTGAAAGACTGAGG + Intronic
992635065 5:78719012-78719034 TCCACATTGAGCTAAGTCTGTGG - Intronic
992642434 5:78779743-78779765 GACAGAGTGAGCAATGGCTGGGG + Exonic
994251171 5:97539308-97539330 GCCACAAGGTGCAGAGACTGGGG + Intergenic
996862005 5:128078381-128078403 GCCTCATTGAGCCGAGACTGCGG - Intergenic
997423577 5:133787758-133787780 GGCAGAGTGAGCACAGGCTGGGG - Intergenic
997698302 5:135878654-135878676 ACCACAGTGCCCAGAGACTGAGG + Intronic
998766180 5:145489818-145489840 ACGACAGAGAGCAAAGTCTGAGG - Intronic
999417470 5:151411582-151411604 GCCAAACTGAGCAAAGGCTTCGG + Intergenic
1001142387 5:169155578-169155600 ACTGCAGTGAGCAAAGACTCAGG - Intronic
1001403745 5:171461485-171461507 GCCACAGGGAGAGAAGACTCTGG - Intergenic
1001610187 5:172994152-172994174 TCCACAGTCACCAAATACTGTGG - Intronic
1001881675 5:175250004-175250026 GCCACAGTGCTCACATACTGTGG - Intergenic
1003321913 6:5059277-5059299 GCCACAGTGAGCTATGACGGTGG + Intergenic
1003952184 6:11126810-11126832 GCTACAGTGAACAAAGACTTAGG - Intronic
1004090014 6:12491433-12491455 GCCAGAGTGTGCAAAGAATGAGG + Intergenic
1004197380 6:13516955-13516977 GCCAAAGCGTGCAAAGACTGAGG + Intergenic
1004348331 6:14868899-14868921 GCCACAGTAAGAAAGGACTTAGG - Intergenic
1005802949 6:29445567-29445589 GAAGCAGTGAGCATAGACTGTGG - Intronic
1006098727 6:31672348-31672370 ATCACAGTGACCAAAGAATGTGG - Exonic
1006577697 6:35058194-35058216 ACGAGAGTGAGCAAGGACTGTGG + Intronic
1006685194 6:35826927-35826949 GCCAGAGTGAGAAAAGAATAAGG - Intronic
1006914706 6:37586665-37586687 GTTACAGTGAGCCGAGACTGTGG + Intergenic
1008669175 6:53749252-53749274 CCCACAGTGAGCACATACTCTGG + Intergenic
1010435398 6:75824255-75824277 GCCAGAGGCAGCAAATACTGAGG - Intronic
1012039285 6:94184460-94184482 GCTACAGTGAGTTAAGACTTTGG - Intergenic
1013612024 6:111804613-111804635 ACCCCAGTGAACAAAGACTAGGG - Intronic
1013614129 6:111825748-111825770 GCCACAGTTAGGAAAGGCTTGGG + Intronic
1014112104 6:117629929-117629951 TACACAGTGAGCAGGGACTGAGG - Intergenic
1014170917 6:118278245-118278267 TCCACAGTGAGCACAGAACGTGG + Intronic
1014208110 6:118678962-118678984 GCAACAGGGAGTAAAGAGTGGGG - Intronic
1014371403 6:120613260-120613282 GCTGCAGTGAGCTAAGATTGTGG + Intergenic
1015174367 6:130290377-130290399 GCCATTAAGAGCAAAGACTGAGG - Intronic
1015692387 6:135939566-135939588 GCCACAGTGTGTAGAGATTGAGG + Intronic
1016012286 6:139149785-139149807 CCCACAGTGAGGAGAAACTGAGG + Intronic
1016157750 6:140833839-140833861 GTCCCATTGAGCAAATACTGTGG - Intergenic
1016637844 6:146315323-146315345 GCTACAGTGAGCTATGATTGTGG + Intronic
1017474449 6:154774321-154774343 GCCACAGTGAGCTATGATCGTGG - Intronic
1018007484 6:159636650-159636672 GCTGCAGTGAGCAGAGATTGTGG + Intergenic
1019083735 6:169454976-169454998 GCATGGGTGAGCAAAGACTGCGG + Intergenic
1019579043 7:1751050-1751072 GACACAGAGGGCAAAGACAGGGG + Intergenic
1019821913 7:3250504-3250526 GTTGCAGTGAGCAGAGACTGTGG - Intergenic
1022055071 7:26722451-26722473 GCTGCAGTGAGCCAAGATTGAGG - Intronic
1022662895 7:32382849-32382871 GCGACAGTGAGCAAGGAGTAGGG - Intergenic
1026801338 7:73401946-73401968 CTCACAGTGAGCCGAGACTGTGG - Intergenic
1027886245 7:83909567-83909589 GCTACAGTAAGCCAAGATTGCGG - Intergenic
1028181623 7:87731038-87731060 GCTACAGTGACCAAAGACTAAGG + Intronic
1029225524 7:99025301-99025323 GTTGCAGTGAGCCAAGACTGCGG - Intergenic
1029226978 7:99035301-99035323 GCCCCGCTGAGCAAAGACTGTGG - Intronic
1029242875 7:99176816-99176838 GCTACAGTGAGCAACCATTGCGG + Intronic
1030361145 7:108596442-108596464 GCCACAGTGAGAGAAGAAGGAGG - Intergenic
1031031537 7:116740919-116740941 GCCACACTGAACAAAGGGTGGGG - Exonic
1031260212 7:119508085-119508107 GCTACAGTGACCAAAGACTAAGG + Intergenic
1032231485 7:130078578-130078600 GTTGCAGTGAGCCAAGACTGCGG - Intronic
1032499744 7:132391513-132391535 GCCTGAGGGAGCAAAGAATGGGG + Intronic
1034202426 7:149290877-149290899 GTCACAGTGAGCCCAGAGTGGGG + Intronic
1035166906 7:156996131-156996153 GCTACAGTGAGCTATGATTGTGG - Intronic
1035388701 7:158490830-158490852 GCCACACTGTGCAGTGACTGTGG + Intronic
1035818811 8:2569461-2569483 GAGACAGAGAGCAAAGGCTGCGG + Intergenic
1036009848 8:4709549-4709571 TCCACGGTGAGCAACGACAGAGG - Intronic
1038222128 8:25620548-25620570 GCTACAGTGATCAAACAATGTGG + Intergenic
1039172866 8:34768355-34768377 GCCAGAGTTAGCAAAATCTGGGG - Intergenic
1040696667 8:50007679-50007701 GTCACAGTGAGCTAAGAGGGTGG + Intronic
1042156117 8:65845853-65845875 GGGCCAGTGTGCAAAGACTGGGG - Intergenic
1042600775 8:70497371-70497393 GCTGCAGTGAGCCGAGACTGCGG + Intergenic
1042847492 8:73183486-73183508 GCTTCAGTGAGCAAACTCTGAGG - Intergenic
1043003671 8:74791442-74791464 GACATAATGAGCAAAGACTGAGG - Intronic
1043661199 8:82744305-82744327 GCTACAGTGAGGAAGGACTCAGG - Intergenic
1044970138 8:97611395-97611417 GTTGCAGTGAGCCAAGACTGTGG + Intergenic
1045503718 8:102763052-102763074 GGCACAGAGAGCAAAGACGTTGG + Intergenic
1045810991 8:106219998-106220020 GACACAGAGAGCAGAGACAGTGG - Intergenic
1046562563 8:115856392-115856414 GCCTAACTGAGCAGAGACTGAGG - Intergenic
1048043490 8:130752468-130752490 GCCCCAGTGATCTGAGACTGGGG - Intergenic
1049021407 8:139959933-139959955 GACACAGAGAGCAAGGGCTGTGG + Intronic
1049730763 8:144176964-144176986 GCCGCAGTGAGGCAAGAGTGAGG - Intronic
1049817685 8:144615256-144615278 GCTACAGTGAGCTATGACTGTGG + Intergenic
1050615336 9:7395896-7395918 GCCACAAAGAGCAAAGAAAGAGG - Intergenic
1051433285 9:17002925-17002947 GCCACAGTGAACATTGACAGGGG - Intergenic
1053187572 9:36031386-36031408 GCCAAAGAGAGTAAAGAATGGGG + Intergenic
1053380539 9:37646137-37646159 GCTTCAGTGAGCCAAGACTCAGG - Intronic
1053404313 9:37858556-37858578 GCCACAGAGAGTTAAGAATGAGG + Intronic
1056063578 9:82910205-82910227 GACAGAGTGAGCAAGGACTTGGG - Intergenic
1056616439 9:88171182-88171204 GCCACAGAGACCACAGTCTGGGG - Intergenic
1056637953 9:88347006-88347028 GTTACAGTGAGCCAAGATTGCGG + Intergenic
1056773163 9:89494332-89494354 TCCACAGTTAGCAAAGGGTGGGG - Intronic
1057068531 9:92076381-92076403 GCCACTGGGAGCAGATACTGGGG - Intronic
1059254275 9:112914344-112914366 GCAGCAGTGAGCTGAGACTGTGG + Intergenic
1060140945 9:121209392-121209414 TCCATGGTGAGCAAAGAGTGGGG + Intronic
1060167792 9:121433785-121433807 GGCCCATTGAGCAAATACTGTGG - Intergenic
1060193396 9:121607363-121607385 GCTACAGTGAGCCATGATTGTGG - Intronic
1062553077 9:137099307-137099329 AGCACAGTGAGCACAGCCTGTGG - Intronic
1185975529 X:4715370-4715392 GCTACAGTGAGCCATGATTGTGG - Intergenic
1188192090 X:27183369-27183391 GCTTCAGTGACCAAAGACTTAGG + Intergenic
1190496228 X:51030855-51030877 GACTGAGTGAGTAAAGACTGGGG - Intergenic
1190509773 X:51163219-51163241 GACTGAGTGAGTAAAGACTGGGG + Intergenic
1190628758 X:52364953-52364975 GTTGCAGTGAGCCAAGACTGGGG - Intergenic
1192330170 X:70169118-70169140 GCCGCAGAGAGCAAATACTTTGG - Intergenic
1192459992 X:71309034-71309056 GTTGCAGTGAGCCAAGACTGCGG - Intergenic
1193019067 X:76770200-76770222 GCTACAGTGAGCTGAGATTGAGG + Intergenic
1194335710 X:92643944-92643966 GGCTCAGTGGGAAAAGACTGTGG - Intergenic
1196081911 X:111641670-111641692 GCTGCAGTGAGCTATGACTGTGG - Intergenic
1199773731 X:150992631-150992653 GTTGCAGTGAGCCAAGACTGTGG + Intergenic
1200644139 Y:5760695-5760717 GGCTCAGTGGGAAAAGACTGTGG - Intergenic
1200950786 Y:8897722-8897744 TCCAAAGTGAGCAAAGAGTTGGG - Intergenic