ID: 906988775

View in Genome Browser
Species Human (GRCh38)
Location 1:50714737-50714759
Sequence AATCAAATCCTTCTCCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 4, 3: 11, 4: 218}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906988768_906988775 22 Left 906988768 1:50714692-50714714 CCCCAAGAATGGCTTGGGTTAAC 0: 1
1: 0
2: 3
3: 25
4: 213
Right 906988775 1:50714737-50714759 AATCAAATCCTTCTCCTCACTGG 0: 1
1: 0
2: 4
3: 11
4: 218
906988773_906988775 -10 Left 906988773 1:50714724-50714746 CCCTTGGAAGATGAATCAAATCC 0: 1
1: 1
2: 1
3: 9
4: 215
Right 906988775 1:50714737-50714759 AATCAAATCCTTCTCCTCACTGG 0: 1
1: 0
2: 4
3: 11
4: 218
906988767_906988775 23 Left 906988767 1:50714691-50714713 CCCCCAAGAATGGCTTGGGTTAA 0: 1
1: 0
2: 1
3: 13
4: 134
Right 906988775 1:50714737-50714759 AATCAAATCCTTCTCCTCACTGG 0: 1
1: 0
2: 4
3: 11
4: 218
906988770_906988775 20 Left 906988770 1:50714694-50714716 CCAAGAATGGCTTGGGTTAACAG 0: 1
1: 1
2: 0
3: 7
4: 95
Right 906988775 1:50714737-50714759 AATCAAATCCTTCTCCTCACTGG 0: 1
1: 0
2: 4
3: 11
4: 218
906988769_906988775 21 Left 906988769 1:50714693-50714715 CCCAAGAATGGCTTGGGTTAACA 0: 1
1: 0
2: 1
3: 9
4: 89
Right 906988775 1:50714737-50714759 AATCAAATCCTTCTCCTCACTGG 0: 1
1: 0
2: 4
3: 11
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906988775 Original CRISPR AATCAAATCCTTCTCCTCAC TGG Intronic
901044887 1:6390120-6390142 AACCACAGCCTTCTCTTCACAGG + Intronic
901210740 1:7524756-7524778 ATTCACATCCTGCCCCTCACAGG + Intronic
904601395 1:31674548-31674570 TCTCAAATCCATCTCCTCCCTGG + Intronic
906862344 1:49375166-49375188 AATCATATCATTATTCTCACAGG - Intronic
906988775 1:50714737-50714759 AATCAAATCCTTCTCCTCACTGG + Intronic
907373270 1:54016528-54016550 AATCACCTCCTTTTCCTCATCGG - Intronic
909716599 1:78715400-78715422 AATCAAATCTTTCTGTGCACAGG - Intergenic
910929217 1:92425902-92425924 AATCAAGTCCTGCTCCTCAGTGG - Intergenic
911430112 1:97774290-97774312 AAACAGATCCTTTTACTCACAGG - Intronic
911662052 1:100511871-100511893 AATCAAATCCTTCTCATGTTTGG + Intronic
912508984 1:110175546-110175568 AATCCAATCCTTCTCATCCCTGG - Intronic
912930700 1:113957591-113957613 TATAAAATCCTTCTCCTAACAGG - Intronic
915081173 1:153353741-153353763 AGTCAGGTCCCTCTCCTCACAGG - Intergenic
915700841 1:157794700-157794722 ATTTTAATCCTTCTCATCACTGG - Intronic
916106043 1:161433227-161433249 AGTCAAAGCTTTGTCCTCACTGG - Intergenic
919325003 1:196096534-196096556 ATTCAAATCTTCATCCTCACTGG + Intergenic
919737580 1:200962741-200962763 CCTCAAGTCCTGCTCCTCACTGG - Intergenic
921249438 1:213282438-213282460 GATAAAATCCTGCTCCTCAGAGG + Intergenic
921913186 1:220575043-220575065 AATGAAGTTCTTCTACTCACTGG - Intronic
923068878 1:230544821-230544843 AATCTAATCATTCTCCTACCAGG - Intergenic
923569314 1:235100014-235100036 AGTCAAATTATTCTCCTCTCTGG + Intergenic
923761296 1:236847478-236847500 AAGTAAAGCCTTCTACTCACTGG + Intronic
924160494 1:241226810-241226832 TATCAAATTATTCTCCACACAGG + Intronic
924456685 1:244224278-244224300 AATCAACTCTTTCTCCCCAGTGG + Intergenic
924885942 1:248216724-248216746 AAACAAATATTTGTCCTCACTGG - Intergenic
1063155030 10:3371565-3371587 ACTCAAATCAGTCTCCTCAAAGG + Intergenic
1064926730 10:20577793-20577815 AAGCAAACCCTTCCCCTCAAAGG - Intergenic
1065510948 10:26478042-26478064 AGTCAAATCCCTGCCCTCACCGG + Intronic
1066639807 10:37544555-37544577 AATGTAATCCTTTTCCCCACAGG + Intergenic
1068217051 10:53995629-53995651 AATCAATGCCTTCTACTTACAGG + Exonic
1068419890 10:56777874-56777896 AATCAAATCCTGCTTCTACCAGG - Intergenic
1068816734 10:61324019-61324041 AATCAAATCCTATTTGTCACTGG + Intergenic
1072926028 10:99618113-99618135 AATCAATTCCATCTTGTCACAGG + Intronic
1074434529 10:113422660-113422682 AATCTCATCCTTCTACTCAATGG + Intergenic
1075413911 10:122248823-122248845 AATCAGATCCTCCTCCTCCGTGG - Intronic
1077925961 11:6682388-6682410 GATCAAATCCTTCTCCTAGAGGG + Exonic
1078479848 11:11666024-11666046 AATGAATTCCTTCTCCTAGCAGG + Intergenic
1078633082 11:13022919-13022941 AATCAGATCCTTCTCTTCCTAGG + Intergenic
1078857627 11:15219569-15219591 CATCAAATCCTTGGCCTCTCTGG + Intronic
1078869917 11:15333830-15333852 AATCAAACTATTCTCCTCAATGG - Intergenic
1079908278 11:26276781-26276803 AATGATATCCTTCACCTCTCTGG + Intergenic
1080674455 11:34412015-34412037 ATTCACTTCCTTCTCCCCACAGG - Intergenic
1081478934 11:43465643-43465665 AATCAAATAATTTTCCACACGGG + Intronic
1084726336 11:70944715-70944737 AATCACATCCATCTGCTCAGTGG + Intronic
1085575566 11:77599658-77599680 AATCAAAACCTCCGCCTCCCCGG + Intronic
1086551795 11:88060992-88061014 AAACAAATTGTTGTCCTCACAGG - Intergenic
1087285892 11:96264928-96264950 CTTCAAACTCTTCTCCTCACAGG - Intronic
1088693397 11:112346403-112346425 AAACACAGCCATCTCCTCACTGG + Intergenic
1088902682 11:114130068-114130090 AAACAAAGCCTGCTCCTCCCTGG - Intronic
1090577104 11:128117097-128117119 AATAAAATCCTGCTCATCCCTGG + Intergenic
1091347581 11:134865438-134865460 AATCTCATCCTTCCCCTCAAGGG - Intergenic
1091358019 11:134953232-134953254 TAACATATCCTTCACCTCACAGG - Intergenic
1093912296 12:24761930-24761952 AATCGAATCATTGTCCTCAATGG + Intergenic
1095607324 12:44085045-44085067 AATCACATCATTTTCCTCACTGG - Intronic
1096610918 12:52801081-52801103 AATCACAACCTTGTCCTCGCTGG + Intergenic
1097021725 12:56025618-56025640 AGCCAAAGCCTTCTCCTCAATGG + Intronic
1098329781 12:69341205-69341227 GGTCAAGTCCTACTCCTCACAGG + Intergenic
1099082841 12:78207940-78207962 GATCAAGTCCTTATCATCACTGG - Intronic
1101654583 12:106708664-106708686 TATCAAAGCCATCTGCTCACAGG - Intronic
1102142994 12:110631897-110631919 AAACAACTCCTTCCACTCACTGG - Intronic
1105602369 13:21898788-21898810 AATCAAATTCTTATCCTCACTGG - Intergenic
1108766913 13:53642320-53642342 AATCAATTCCCTCTGTTCACAGG - Intergenic
1109352368 13:61200873-61200895 AATCAAATACTTCTCCTAACAGG + Intergenic
1109427525 13:62185428-62185450 AATATAATCCTTGTCCTCAATGG - Intergenic
1109814127 13:67556813-67556835 AATGAAATCCTTCTTGTAACAGG + Intergenic
1110205893 13:72912757-72912779 AGTAGAATACTTCTCCTCACTGG + Intronic
1112006032 13:95254517-95254539 AAAAAAATCCTGCTCCTCCCAGG + Intronic
1113168026 13:107465611-107465633 AATGGAATCCTACTCCACACTGG + Intronic
1116674123 14:47883545-47883567 GATTAAATCCTCCTCCTCAGTGG + Intergenic
1117808808 14:59523394-59523416 AAGAAAATCCTTCACCTCGCTGG - Intronic
1118070505 14:62242008-62242030 AATAAAATCTTTTTCCTCAGTGG - Intergenic
1119937121 14:78602318-78602340 AAGCAAAGCATTCTCCTCCCAGG + Intronic
1120442691 14:84559888-84559910 AATCAATGGCTTCTCCCCACTGG - Intergenic
1202888353 14_KI270722v1_random:130615-130637 AATAAAATTCTACTCCTCAAAGG - Intergenic
1124658608 15:31527544-31527566 AATCAAGTGCTTTTCCTCTCTGG + Intronic
1125172275 15:36779155-36779177 ATTAAAATCCTTCTCAACACGGG + Intronic
1127725530 15:61745589-61745611 AATCTAATCCTTCTCCCTCCTGG + Intergenic
1128838139 15:70827958-70827980 AACCAGTTCCTTCTCCACACTGG - Intergenic
1129892415 15:79080189-79080211 AATTACTTGCTTCTCCTCACTGG + Intronic
1131048584 15:89332019-89332041 AAACAAATCTTTCTTGTCACTGG + Intronic
1132298942 15:100764523-100764545 ACTCACATCCTTCTCCTGAGTGG - Intergenic
1133619613 16:7513746-7513768 AAGCAGCCCCTTCTCCTCACTGG - Intronic
1134568114 16:15268604-15268626 CATCAAATCCCTCTCCCCAAAGG + Intergenic
1134734321 16:16487751-16487773 CATCAAATCCCTCTCCCCAAAGG - Intergenic
1134933181 16:18224528-18224550 CATCAAATCCCTCTCCCCAAAGG + Intergenic
1139171530 16:64635808-64635830 AATCCAAACCTTCACATCACTGG + Intergenic
1143006137 17:3836021-3836043 AATCAACACCTTCTCCTCACAGG + Intronic
1143428895 17:6864503-6864525 AAACAAAACCTTATCCTCAAAGG - Intergenic
1147164474 17:38586085-38586107 ACTCAGCTCCTTCTCCTCCCAGG - Intronic
1148448946 17:47761606-47761628 AATCTAATCTTCCTCCTCAAGGG - Intergenic
1148476100 17:47929568-47929590 AATCAACTTCTTGTCCTCTCTGG - Intergenic
1148621807 17:49040224-49040246 AATAAAATCTTTCTTCTTACAGG + Intronic
1149007353 17:51819829-51819851 ACTCAAATCCTGCTCCCTACTGG + Intronic
1150860113 17:68792632-68792654 AATGAAAGCCTTCTCTTTACAGG - Intergenic
1151162223 17:72175413-72175435 AAGCAAATGCTTCTCCTCCCAGG + Intergenic
1153011595 18:544769-544791 AATCACATGCTTTTCCTCTCAGG - Intergenic
1155221359 18:23689269-23689291 AATTAGATCGTTCTCCTCTCTGG - Intergenic
1155548261 18:26937918-26937940 ATTAAAATCCTGGTCCTCACAGG + Intronic
1158007166 18:52685936-52685958 AATCCAAGCCTTCTCCTCAAGGG + Intronic
1158428516 18:57361651-57361673 AATCAAATCATTCCCATCCCTGG + Exonic
1158888902 18:61855122-61855144 CTTCAAATCCTTCTTCCCACTGG - Intronic
1159699255 18:71604006-71604028 ACTCAAGTCCTTCTTGTCACAGG - Intergenic
1163854776 19:19692732-19692754 AATCAAATTCCTATTCTCACTGG + Intergenic
1164507703 19:28873035-28873057 AATAAAATGGTTCTCCCCACAGG - Intergenic
1167168886 19:47817929-47817951 ACTCAGCTCCTTGTCCTCACTGG - Intronic
1202663744 1_KI270708v1_random:97407-97429 AATAAAATTCTACTCCTCAAAGG - Intergenic
925981967 2:9184387-9184409 AAACACATCTTTCTCCTCCCAGG - Intergenic
926428273 2:12759658-12759680 ATGCAAGTCCTTCTCTTCACAGG - Intergenic
928931113 2:36625430-36625452 AATCAAATCAGTCTCCCCAAGGG + Intronic
929001241 2:37349057-37349079 AGTCAAATGCTTTTCCACACAGG + Intronic
929331582 2:40688403-40688425 AATCAAATCATTCTAATTACAGG + Intergenic
930406527 2:50964154-50964176 AGTCTAAACCTTCTACTCACTGG - Intronic
932012599 2:67993334-67993356 AAACAAGTCCTTCATCTCACTGG + Intergenic
932894095 2:75622120-75622142 AATAAAATACTCCTCCCCACTGG + Intergenic
935176258 2:100652080-100652102 TATCACATCCTGATCCTCACAGG + Intergenic
936591503 2:113808814-113808836 ACTCAAATCAGTCTCCTCAAAGG - Intergenic
937583950 2:123523760-123523782 ACTCAAATCAGTCTCCTCAAAGG + Intergenic
939743343 2:145937407-145937429 CATCACAACCTTCTCCTCCCAGG - Intergenic
942926920 2:181445011-181445033 TATAAAATCATTCTCCTCTCAGG - Intergenic
944185010 2:196938510-196938532 AATCATATCTTTTTCCTCAGTGG - Intergenic
946055674 2:216899919-216899941 AATCAACAGCTTATCCTCACAGG + Intergenic
1171229673 20:23473840-23473862 ATTCAATTTCTTCTCCTCAGTGG - Intergenic
1171302017 20:24071275-24071297 AATCATATCCTTCTTCTCCTAGG + Intergenic
1171385177 20:24765021-24765043 AATCACATCCTTTCCCTCCCAGG - Intergenic
1172545434 20:35757239-35757261 AATCAATACCTCCTCCTCAGAGG + Intergenic
1173029308 20:39340127-39340149 CATCAAATTCTACTGCTCACTGG - Intergenic
1174554454 20:51383800-51383822 AATCAAATTCTTGTCCTCAGAGG - Intergenic
1175047689 20:56122704-56122726 AATCAATTACTCCTCCTCTCAGG + Intergenic
1177859837 21:26439404-26439426 TATCAAATACCTTTCCTCACAGG - Intergenic
1178123262 21:29491045-29491067 AATGAAATCCTTTTCCTCCTTGG - Intronic
1178344587 21:31814029-31814051 AATCTTATCCTTCTCCACCCAGG + Intergenic
1179058474 21:37957449-37957471 AGTCAATTCCTTCTGCTCAAAGG - Intronic
1180330473 22:11474291-11474313 AATAAAATTCTACTCCTCAAAGG - Intergenic
1181571866 22:23772359-23772381 AATAATATCCCTTTCCTCACAGG + Intronic
1181646529 22:24234160-24234182 CATCAAATCCAGCTGCTCACAGG + Intronic
1183003075 22:34877708-34877730 AATCAAATGATTCACCTCTCAGG + Intergenic
1184328497 22:43810803-43810825 AATAAAATCCTCATCCTCAAAGG + Intronic
1184482894 22:44758498-44758520 ATTCAAATCTACCTCCTCACCGG - Intronic
950584899 3:13885325-13885347 AATTTAATCCTTCACCTGACTGG + Intergenic
951521735 3:23616686-23616708 TCTCAAATCCATCTCCTCAATGG - Intergenic
951688576 3:25371919-25371941 CGTCAAATCCATCTCCTCAGTGG - Intronic
952342412 3:32457275-32457297 AAGCAAACCCTACTTCTCACTGG + Intronic
954595375 3:51819766-51819788 TGTCACATCCTTCTCCCCACAGG - Intronic
957092233 3:75742341-75742363 AATAAAATTCTACTCCTCAAAGG + Intronic
957468817 3:80631894-80631916 AAGCAAGTCCATCTCCTCAGAGG + Intergenic
961012308 3:123444606-123444628 AACCAAATGCTTCTCCTAATTGG + Intronic
962082404 3:132154516-132154538 TATCAATTCCTTTCCCTCACTGG + Intronic
962665733 3:137651876-137651898 AATCATACCCTCTTCCTCACTGG + Intergenic
963642731 3:147879211-147879233 AATTAATGACTTCTCCTCACTGG - Intergenic
967597173 3:191340141-191340163 AATTTAATCTGTCTCCTCACAGG + Intronic
969832974 4:9813410-9813432 GATGAAATCCTAATCCTCACTGG + Intronic
970362846 4:15327301-15327323 ACTCAAATCCTTATCTTCACCGG + Intergenic
970519594 4:16868943-16868965 ATTAAAATCATTCTCATCACCGG - Intronic
970908571 4:21246731-21246753 AATCAAACCCTTTTACTCAGTGG - Intronic
976898133 4:90137486-90137508 AATACCTTCCTTCTCCTCACTGG - Intronic
978111620 4:104971119-104971141 AATGAACTCCCTCTGCTCACAGG + Intergenic
978259929 4:106743334-106743356 AATCAAATATCTGTCCTCACTGG + Intergenic
978760026 4:112346929-112346951 AAGCAAATACATCTCCTCCCAGG - Intronic
980819660 4:137997300-137997322 ACTCAAAACCTTCTTCTCATGGG + Intergenic
982275015 4:153629601-153629623 ATTCAAATTCCTCTCCTCCCTGG + Intronic
983406402 4:167336252-167336274 TTTCAAAACCTTCTACTCACTGG + Intergenic
985935763 5:3096617-3096639 AATCAAATCCATCTCCTCTCAGG - Intergenic
986744193 5:10730176-10730198 AACAAAATCCCTCTTCTCACAGG - Intronic
987191438 5:15482742-15482764 ACTCAAATCAATCTCCTCAAAGG + Intergenic
987570671 5:19654038-19654060 AATCTCATACTTCTCATCACAGG + Intronic
988485653 5:31666196-31666218 AACCATGTCCTTCTCCTCCCTGG - Intronic
988588242 5:32526451-32526473 CATGAAATCCTTCTCCACGCCGG + Intergenic
989422839 5:41260011-41260033 AAACAATTCTTTCTCCTCAGAGG - Intronic
990149841 5:52803904-52803926 ACTCAAATCTTTTTCCTGACTGG - Exonic
990992877 5:61702230-61702252 AAGCAAGTTCTTCTCCTCAGTGG + Intronic
991676822 5:69096486-69096508 AATCAAATTCAACTCCTGACTGG + Intronic
994355709 5:98792120-98792142 AATCAAATGTTTCACATCACTGG - Intronic
997135515 5:131320932-131320954 AATCAGATCCTTATCTTCAGAGG + Intronic
998676307 5:144412475-144412497 AATCTACTCCTTATCTTCACAGG - Intronic
999199295 5:149804706-149804728 ACTCCAATCCTTCCACTCACGGG - Intronic
1002174364 5:177393225-177393247 GATCAATTCCTTATCCTCAGGGG - Intronic
1002850611 6:993242-993264 AATCATATGCTTCACCTCAGTGG + Intergenic
1004203196 6:13569235-13569257 AATCAAAGCCTCTACCTCACTGG + Intergenic
1004292669 6:14382721-14382743 AATCCCATCCCTCTTCTCACTGG + Intergenic
1008181492 6:48335589-48335611 AACCAAAGCTTTCTCCTCCCTGG + Intergenic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1009798134 6:68498302-68498324 AGTCTAATCATTCTCCTCATAGG + Intergenic
1014602192 6:123427457-123427479 AATGTAATCCTTCTTCTTACAGG + Intronic
1014786362 6:125624265-125624287 AACCTAAACCTTGTCCTCACTGG + Intergenic
1021611043 7:22458362-22458384 CATCAACTCCTCCTCCTCCCTGG - Intronic
1022595795 7:31712535-31712557 CATCAAATCCTCCTACTCTCAGG + Intergenic
1022992161 7:35719169-35719191 AATTAAATCCTTCTTGTCAAAGG - Intergenic
1023555522 7:41418638-41418660 AATCAAAACCTGCTCTTCAAAGG - Intergenic
1024200084 7:47097770-47097792 AATTAAAACCTACTCCTCCCGGG + Intergenic
1024210327 7:47197745-47197767 AAAGAAATCCTTCTCTTCAGTGG - Intergenic
1024550234 7:50556655-50556677 AATCAAATCCATCATCTCAAGGG + Intronic
1025202910 7:56973111-56973133 AATAAAAGCCTCCTCCTCAAAGG + Intergenic
1025669034 7:63603815-63603837 AATAAAAGCCTCCTCCTCAAAGG - Intergenic
1026201416 7:68217908-68217930 AACAAAATCCTTGTCCTCAGAGG - Intergenic
1028845216 7:95472571-95472593 AATGTAATACTTTTCCTCACAGG + Intergenic
1029713089 7:102310399-102310421 CATCAAAATCTCCTCCTCACTGG - Intronic
1031887592 7:127257352-127257374 CAGGAAATCATTCTCCTCACAGG + Intergenic
1031938045 7:127756212-127756234 AATAGAATCCATCTCCCCACAGG - Intronic
1034738934 7:153455453-153455475 TATCAAATCCCAGTCCTCACTGG + Intergenic
1036576557 8:10032913-10032935 AATGAAATCCTTCACCTCCTTGG - Intergenic
1037220214 8:16509968-16509990 AAGCAGATCCTTCTTCTCCCAGG + Intronic
1038327614 8:26584332-26584354 AATCAAATACTTATGCTCAATGG - Intronic
1039373912 8:37014214-37014236 AAGCGAATCCTCATCCTCACCGG - Intergenic
1044281271 8:90359762-90359784 AATCAAATCCTTTTATTCATAGG - Intergenic
1044297244 8:90543468-90543490 AATCACCTCCTTTTCCTGACAGG - Intergenic
1045201362 8:99985229-99985251 AATCACATCCTTGACCTCATGGG + Intronic
1046317264 8:112520906-112520928 CATCAAATCCATCACCTCACTGG + Intronic
1046890308 8:119415414-119415436 AATCAAATCCTTCTCTCACCGGG - Intergenic
1047730621 8:127725029-127725051 AAACAAATCCTTGTCCTCCAAGG - Intergenic
1047885617 8:129247152-129247174 AATGAATTTCTCCTCCTCACTGG + Intergenic
1047919597 8:129620501-129620523 AATCATATCATTGTCCTTACAGG + Intergenic
1049055105 8:140230259-140230281 AATAATATCCTTCTGCTAACAGG - Intronic
1050701192 9:8341121-8341143 AATCAGATCCTTCTACTCCACGG + Exonic
1051891114 9:21944089-21944111 AGTCAAATCCTTATCCTCTTTGG + Intronic
1052031636 9:23635932-23635954 AGTCAAGTTCTTCACCTCACTGG + Intergenic
1053288313 9:36864158-36864180 AAGCAAGCCCTTTTCCTCACAGG + Intronic
1055101797 9:72473236-72473258 AGGCAAATCCTGCTACTCACTGG + Intergenic
1057486910 9:95492806-95492828 AAAAAAATGCATCTCCTCACTGG - Intronic
1058526071 9:105858925-105858947 ATTCAATTCCTGCTCTTCACTGG - Intergenic
1061394118 9:130333967-130333989 CATCAAAGCCTTCACCACACTGG - Intronic
1061771171 9:132923296-132923318 AATGAAAGCATTCACCTCACAGG + Intronic
1203485537 Un_GL000224v1:50545-50567 AATAAAATTCTACTCCTCAAAGG - Intergenic
1186843268 X:13506270-13506292 ACTCAAATCCATCTCCCCAAAGG - Intergenic
1189209590 X:39273442-39273464 AATCAAGTCATTCTCATCCCCGG - Intergenic
1190819218 X:53957917-53957939 AATCAAATACTACTCCTAACTGG + Intronic
1192013205 X:67298305-67298327 AATTACATTCTTCTCCTCAAAGG - Intergenic
1195138837 X:101938337-101938359 AATGATAGCTTTCTCCTCACAGG - Intergenic
1195140943 X:101959252-101959274 ACTCAAATCATTCTCCCCAAAGG + Intergenic
1195341018 X:103906246-103906268 AATCAAATCCTGCTCTTCATTGG + Intergenic
1195635979 X:107116637-107116659 AATCAATACCTACTCCTCAATGG + Exonic
1196005927 X:110837126-110837148 AAGCAATTGCTTTTCCTCACAGG + Intergenic
1197806741 X:130404778-130404800 TATCACAGCCTTCTTCTCACGGG - Intronic
1198767895 X:140096860-140096882 AATCAGAGCCTTCTTCTCTCAGG - Intergenic
1199646284 X:149916055-149916077 AACCAAATCATTCTCTTCATAGG - Intergenic